General expression framework of artificial circular RNA targeting to inhibit miRNA-34a, and expression method and application thereof
A mir-34a-5p, circular technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, biochemical equipment and methods, can solve problems such as obstacles to the development of analogue or antagonist drugs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: The involvement and synthesis of the artificial circular RNA expression framework sequence and the corresponding linear RNA control expression framework sequence.
[0038] 1. Use the miRbase database to query the sequence of human miR-34a-5p as "uggcagugucuuagcugguugu", and its reverse complementary DNA sequence is "ACAACCAGCTAAGACACTGCCA", replace the general framework formula I with this sequence
[0039] "34inh". The LS sequence is "GTGTGT" and the IS sequence is
[0040] "ACAAAACAGCCACGCTTCGAGCACGAATCGCCAACTCACGAACG", natural number n=5, combined with the US and DS sequence elements in the general framework formula I shown in SEQ ID NO.1 and SEQ ID NO.2, to obtain the general expression framework of the artificial circular RNA molecule rs-ciR34-10, The base sequence is shown in SEQ ID NO.6.
[0041] 2. Randomly scramble the reverse complementary DNA sequence of the above-mentioned miR-34a-5p, and replace the general purpose of the artificial circular RN...
Embodiment 2
[0044] Example 2: Lentiviral Packaging
[0045] 1. 24 hours before transfection, digest 293T cells in the logarithmic growth phase with trypsin, transfer to 10cm cell culture dish, 37°C, 5% CO 2 Cultured in an incubator. After 24 hours, when the cell density reaches 70%-80%, it can be used for transfection. Cell state is critical for virus packaging, so good cell state and low passage times need to be guaranteed.
[0046] 2. Replace the cell culture medium with serum-free medium before transfection.
[0047] 3. Add the prepared plasmid DNA solutions (lentiviral plasmid 10 μg, helper plasmid pLP1, pLP2, pLP / VSVG each 5 μg) into the sterilized centrifuge tube, mix with the corresponding volume of Opti-MEM, and adjust the total volume to 1.5ml.
[0048] 4. Shake the Lipofectamine 2000 reagent gently, take 60 μl Lipofectamine 2000 reagent and mix it with 1.5ml Opti-MEM in another tube, and incubate at room temperature for 5 minutes.
[0049] 5. Mix the diluted DNA with the di...
Embodiment 3
[0061] Example 3: RT-PCR detection of circular RNA molecule expression in LO2 cells infected with lentivirus
[0062] 1. Resuscitate LO2 cells, according to the corresponding culture conditions, at 37°C, 5% CO 2 Incubator cultivation.
[0063] 2. Inoculate the cell suspension in a 6-well plate (400,000 / well), 37°C, 5% CO 2 Incubator cultivation.
[0064] 3. Add appropriate amount of artificial circular RNA overexpression lentivirus, linear control sequence lentivirus and negative control lentivirus to the cells according to the MOI of colon cancer cells and the titer of each virus, and at the same time add Polybrene with a final concentration of 8ug / ml to enhance Infect.
[0065] 4. After 24 hours of infection, replace the complete medium without lentivirus to continue the culture.
[0066] 5. After 72 hours of infection, add 1ml Trizol to each well of the 6-well plate, repeatedly pipette 10 times with a 1ml pipette tip, and collect it into an EP tube; centrifuge at 12000g...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com