Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, kit and method for detecting Vibrio parahemolyticus by PSR (polymerase spiral reaction) isothermal amplification reaction

A hemolytic vibrio and isothermal amplification technology, applied in the biological field, can solve the problems of complex operation process, high reagent price, and high cost, and achieve the effect of simple and fast operation, low detection cost, and guaranteed reliability

Active Publication Date: 2019-02-19
SOUTH CHINA UNIV OF TECH
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The gene chip detection and PCR amplification methods developed in recent years have strong specificity, rapidity and sensitivity, but the cost is high
Immunological detection methods, such as ELISA, immunochromatography, etc., have high sensitivity, but the operation process is complicated and the cost is high, so it is not suitable for large-scale detection of samples
At present, the most widely used constant temperature amplification technology-LAMP also has its limitations, such as complex primer design, high false positive rate, and high reagent price

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, kit and method for detecting Vibrio parahemolyticus by PSR (polymerase spiral reaction) isothermal amplification reaction
  • Primers, kit and method for detecting Vibrio parahemolyticus by PSR (polymerase spiral reaction) isothermal amplification reaction
  • Primers, kit and method for detecting Vibrio parahemolyticus by PSR (polymerase spiral reaction) isothermal amplification reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Primer Screening for Detection of Vibrio parahaemolyticus by Polymerase Helical Reaction

[0044] 1. Design primers

[0045] According to the principle of PSR amplification reaction, multiple sets of primers as shown in Table 1 were designed for the tlh target using PrimerPremier software.

[0046] Table 1

[0047] Primer name

Sequence (5'-3')

Ft-tlh-1

ACGCCACGGTTGTAGTTCATTACAAACCAGCAAACACC

Bt-tlh-1

TACTTGATGTTGGCACCGCAGTCCGTCAAACGAATCAG

Ft-tlh-2

AGGTTTGGTTTTCTTGCGTGGAAGAGCCAACCTTATCAC

Bt-tlh-2

GTGCGTTCTTTTGGTTTGGACCACCAGTAGCCGTCAAT

Ft-tlh-3

CGTGATGTTGTAACCTTGCG-TGCGAAAGTGCTTGAGAT

Bt-tlh-3

GCGTTCCAATGTTGTAGTGC-GATGAGCGGTTGATGTCC

accelerated primer name

Sequence (5'-3')

IF-tlh-1

CCAAACTCAAGCGTAA

IB-tlh-1

AGTGAAAGCGGATTATG

IF-tlh-2

ATCACTTCAGACGCTG

IB-tlh-2

CTATGTTCGCTGTTGG

IF-tlh-3

TGTGCCTTGATGAACTCGT

IB-tlh-3 ...

Embodiment 2

[0059] Example 2 Microbiological method for detection of Vibrio parahaemolyticus (V.parahaemolyticus) ATCC27969 based on polymerase helical reaction isothermal amplification technology

[0060] 1. The method for detecting pathogenic microorganisms based on polymerase helical isothermal amplification technology. In this embodiment, Vibrio parahaemolyticus (V.parahaemolyticus) ATCC27969 is taken as an example, and the reagents used are as follows:

[0061] A. the detection primer Ft aqueous solution and the Bt aqueous solution primer, the accelerated primer IF aqueous solution, and the accelerated primer IB aqueous solution with a concentration of 50 μM each have the following sequences (5'-3'):

[0062] Detection primer Ft:

[0063] CGTGATGTTGTAACCTTGCGTGCGAAAGTGCTTGAGAT (SEQ ID NO. 1);

[0064] Detection primer Bt:

[0065] GCGTTCCAATGTTGTAGTGCGATGAGCGGTTGATGTCC (SEQ ID NO. 2);

[0066] Acceleration primer IF: TGTGCCTTGATGAACTCGT (SEQ ID NO.3);

[0067] Acceleration Primer...

Embodiment 3

[0077] The influence of embodiment 3 reaction time on PSR amplification system

[0078]The PSR amplification reaction is an efficient and rapid method for gene detection and analysis, and the detection results can be obtained within 1 hour by designing corresponding accelerated primers. At present, the methods for judging the results of PSR reactions mainly include visual observation and gel electrophoresis verification. However, gel electrophoresis can only be operated in the laboratory and cannot achieve the purpose of on-site detection. Therefore, it is hoped to build a visual reaction system to expand the application range of PSR amplification technology. Therefore, in this experiment, the best time for the best detection of the reaction was determined by visual color change-assisted electrophoresis verification. The PSR amplification reaction system was constructed with the tlh target of Vibrio parahaemolyticus, and the effect of reaction time on the PSR amplification sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers, kit and method for detecting Vibrio parahemolyticus by PSR (polymerase spiral reaction) isothermal amplification reaction. A pair of detection primers Ft / Bt and a pairof acceleration primers IF / IB are designed according to specific target sequence tlh of Vibrio parahemolyticus, and their nucleotide sequences are shown as SEQ ID NO. 1 to 4; the primers ensure thatdetection results are reliable. The invention also provides a kit for detecting Vibrio parahemolyticus by PSR isothermal amplification reaction; the kit has high sensitivity, good specificity, good operational convenience, high operational speed, good result accuracy and reliability and low detection cost, and is suitable for application in small- to medium-sized units and field detection. The kitused herein to detect Listeria monocytogenes by polymerase spiral reaction; the method herein never causes time loss due to temperature changes, has low time consumption, the amplified product has noneed for gel electrophoresis, and after developing with a fluorescent dye, the results can be judged with eyes.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a primer, a kit and a method for detecting Vibrio parahaemolyticus by PSR isothermal amplification reaction. Background technique [0002] Vibrio parahaemolyticus is a halophilic bacterium that mainly exists in coastal seawater, seabed sediments, and seafood such as fish, shrimp, shellfish, and oysters. Many people cause food poisoning due to eating uncooked seafood contaminated by Vibrio parahaemolyticus, which has a high proportion and great harm in bacterial food poisoning. At present, most of the routine detection methods in our country have to go through the reaction process of selective culture, biochemical identification and serology. These experiments are cumbersome and take 5 to 6 days (d), and the detection rate is low, which brings difficulties to seafood production, entry-exit inspection and quarantine, and food hygiene supervision. There are reports of food poisoning c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/63
CPCC12Q1/6844C12Q1/689C12Q2531/119Y02A50/30
Inventor 徐振波陆泽荣徐行勇刘君彦陈玲苏健裕李冰李琳李晓玺张霞
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products