Phyllostachys edulis PeTCP10 protein capable of controlling leaf curling, and applications thereof
A technology of moso bamboo and protein, applied in the field of plant molecular biology, can solve the problem that the function of TCP gene has not been reported yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Sequence Analysis of Protein Encoded by PeTCP10 Gene of Phyllostachys pubescens
[0038] Use the bamboo database to find the PeTCP10 gene, and find the corresponding protein sequence (SEQ ID No.3), and according to the characteristics of the TCP gene, use DNAMAN software to compare the PeTCP protein sequence, find and mark the Non-basic Helix in the PeTCP protein sequence -Loop-Helix( figure 1 ) domain.
Embodiment 2
[0040] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens
[0041] 1. Extraction of TotalRNA from Phyllostachys pubescens leaves
[0042]Use 1mM gibberellin solution to treat healthy Phyllostachys pubescens seeds for 12 hours and then plant them in the medium (black soil: vermiculite=1:3), and in a greenhouse with a photoperiod (light / dark) of 18 / 6h and 25°C cultivated in. After growing for three months, select the moso bamboo seedlings with good growth conditions, get their leaves, and use the Trizol method to extract total RNA after freezing in liquid nitrogen. The specific method is as follows:
[0043] (1) Take 0.1g leaves on the ultra-clean workbench and put them into a sterilized mortar, add liquid nitrogen, quickly grind to powder, and put the powder into a 1.5mL RNAse Free Dof tube;
[0044] (2) Add 1mL Trizol to the tube, vibrate on the vortex for 20s to completely crack it, and let it stand for 5min;
[0045] (3) Then put it into a pre-cooled hi...
Embodiment 3
[0059] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens
[0060] According to the protein coding sequence of Phyllostachys edulis eTCP10, Primers 5.0 was used to design primers for PCR amplification of this fragment. The upstream primer added the GAATTC restriction site of EcoR I, and the downstream primer added the GGTACC restriction site of KpnI.
[0061] The primer sequences are as follows:
[0062] PeTCP10-F:5'-CGGAATTCATGGAGGCGCAGGTGC-3';
[0063] PeTCP10—R:5’—GGGGTACCCTACCGGTGGCCGA—3’
[0064] PCR was carried out using the totalRNA reverse transcription product of moso bamboo leaves as a template, and the reaction system is shown in Table 1:
[0065] Table 1 PCR reaction system
[0066]
[0067] The PCR reaction conditions were: pre-denaturation: 98°C 10min; denaturation: 98°C 10s; annealing: 62°C 5s; extension: 72°C 30s, 33 cycles; total extension: 72°C 10min.
[0068] After the reaction, draw the PCR product for 2% agarose gel electrophoresi...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com