Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Moso bamboo petcp10 protein with the function of controlling leaf curling and its application

A technology of moso bamboo and leaves, applied in the field of plant molecular biology, can solve the problems that the function of TCP gene has not been reported yet

Active Publication Date: 2021-09-10
ANHUI AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the published genes regulating plant leaf development are TCP genes in model plants such as Arabidopsis thaliana and rice, but the function of TCP genes in Moso bamboo has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Moso bamboo petcp10 protein with the function of controlling leaf curling and its application
  • Moso bamboo petcp10 protein with the function of controlling leaf curling and its application
  • Moso bamboo petcp10 protein with the function of controlling leaf curling and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Sequence Analysis of Protein Encoded by PeTCP10 Gene of Phyllostachys pubescens

[0038] Use the bamboo database to find the PeTCP10 gene, and find the corresponding protein sequence (SEQ ID No.3), and according to the characteristics of the TCP gene, use DNAMAN software to compare the PeTCP protein sequence, find and mark the Non-basic Helix in the PeTCP protein sequence -Loop-Helix( figure 1 ) domain.

Embodiment 2

[0040] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens

[0041] 1. Extraction of TotalRNA from Phyllostachys pubescens leaves

[0042]Use 1mM gibberellin solution to treat healthy Phyllostachys pubescens seeds for 12 hours and then plant them in the medium (black soil: vermiculite=1:3), and in a greenhouse with a photoperiod (light / dark) of 18 / 6h and 25°C cultivated in. After growing for three months, select the moso bamboo seedlings with good growth conditions, get their leaves, and use the Trizol method to extract total RNA after freezing in liquid nitrogen. The specific method is as follows:

[0043] (1) Take 0.1g leaves on the ultra-clean workbench and put them into a sterilized mortar, add liquid nitrogen, quickly grind to powder, and put the powder into a 1.5mL RNAse Free Dof tube;

[0044] (2) Add 1mL Trizol to the tube, vibrate on the vortex for 20s to completely crack it, and let it stand for 5min;

[0045] (3) Then put it into a pre-cooled hi...

Embodiment 3

[0059] Cloning of PeTCP10 Protein Coding Sequence of Phyllostachys pubescens

[0060] According to the protein coding sequence of Phyllostachys edulis eTCP10, Primers 5.0 was used to design primers for PCR amplification of this fragment. The upstream primer added the GAATTC restriction site of EcoR I, and the downstream primer added the GGTACC restriction site of KpnI.

[0061] The primer sequences are as follows:

[0062] PeTCP10-F:5'-CGGAATTCATGGAGGCGCAGGTGC-3';

[0063] PeTCP10—R:5’—GGGGTACCCTACCGGTGGCCGA—3’

[0064] PCR was carried out using the totalRNA reverse transcription product of moso bamboo leaves as a template, and the reaction system is shown in Table 1:

[0065] Table 1 PCR reaction system

[0066]

[0067] The PCR reaction conditions were: pre-denaturation: 98°C 10min; denaturation: 98°C 10s; annealing: 62°C 5s; extension: 72°C 30s, 33 cycles; total extension: 72°C 10min.

[0068] After the reaction, draw the PCR product for 2% agarose gel electrophoresi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Phyllostachys pubescens PeTCP10 protein with the function of controlling leaf curling and its application. A bamboo PeTCP10 protein of the present invention, the amino acid sequence of the bamboo PeTCP10 protein is shown in SEQ ID No.3. A gene sequence encoding the PeTCP10 protein of the present invention, the deoxynucleotide sequence of the PeTCP10 protein of Moso bamboo is shown in SEQID No.2. The present invention contains the vector of the deoxynucleotide sequence of the coding gene. The present invention transfers the recombinant overexpression vector pCAMBIA1301-35S-PeTCP10 into wild-type Arabidopsis thaliana through the inflorescence dipping method mediated by Agrobacterium, and the results show that the leaves of PeTCP10 overexpressed transgenic plants are significantly higher than that of wild-type plants, indicating that the moso bamboo PeTCP10 gene can make the leaves of transgenic Arabidopsis curl obviously.

Description

technical field [0001] The invention relates to the field of plant molecular biology, in particular to a bamboo PeTCP10 protein with the function of controlling leaf curling and application thereof. Background technique [0002] Bamboo belongs to the Poaceae Bamboo subfamily. According to the meristematic reproduction characteristics and morphological characteristics of underground stems, it can be divided into three types: uniaxial scattered type, synaxial cluster type, and compound axis mixed type. Moso bamboo (Phyllostachys edulis) is a uniaxial scattered bamboo with fast growth, large biomass and wide cultivation area, and has high economic, cultural and ecological value. Moso bamboo is full of treasures, bamboo poles can be used as building materials, bamboo shoots can be used as food, and other parts can be made into handicrafts and other daily necessities. [0003] TCPs (TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS) are plant-specific transcription ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/66C12N1/21C12N15/11A01H5/12A01H6/20C12R1/01
CPCC07K14/415C12N15/66C12N15/8261
Inventor 项艳刘欢龙吴敏高亚蒙史亚男
Owner ANHUI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products