Molecular marker of female flower regulating gene g in muskmelon and its application
A muskmelon and g gene technology, applied in the field of agricultural biology, can solve the problems of time-consuming, labor-intensive and complicated breeding of all females, and achieve the effects of improving the breeding effect, saving time and cost, and clearing the breeding selection goals.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1. Development of g gene-specific markers and detection of offspring populations
[0051] 1. Development of g gene-specific markers
[0052] The marker g-FR is designed according to the location of the g gene, and the marker is composed of the primer shown in sequence 1 and the primer shown in sequence 2, which is a g gene-specific marker.
[0053] Primer F: AAGGTACTCCAAATGAATGGCT (SEQ ID NO: 1);
[0054] Primer R: TTAAATCGGGTCGGTTCGGT (SEQ ID NO: 2).
[0055] 2. Establishment of g gene-specific marker detection method
[0056] Melon material B15 is an all-hermaphroditic flowering plant type, and the whole plant only bears one type of complete flowers. The genotype has been identified as aagg, that is, it contains the g gene.
[0057] The melon material 054 is a male whole plant type, with male flowers attached to the main vine, male flowers and complete flowers attached to the side branches, and the genotype has been identified as aaGG, that is, it contains ...
Embodiment 2
[0088] Example 2, the application of marker g-FR in identifying the distribution of g gene in melon germplasm resources
[0089]In order to identify new all-hermaphroditic flower resources and understand the distribution of the g gene, 34 melon resources shown in Table 1 were detected by PCR using g-FR markers. The unisexual flower materials 1520A and B24 (Hefei Pangzi Agricultural Products Co., Ltd.) (known genotype as GG) were used as controls.
[0090] If a PCR amplification product of 100-200bp is obtained, the offspring of the melon to be tested contains or is candidate to contain the g gene; if no PCR amplification product of 100-200bp is obtained, the offspring of the melon to be tested does not contain or the candidate does not contain the g gene.
[0091] The result is as image 3 and as shown in Table 1, image 3 Among them, lanes 1-36 are: melon materials B15, B18, 054, B1, B2, B3, B4, B5, B6, B7, B8, B9, B10, B11, B12, B13, B14, B16, B17, B19 , HP1, HP2, HP3, HP...
Embodiment 3
[0098] Embodiment 3, the application of marker g-FR in cultivating all female lines of muskmelon
[0099] In order to rapidly breed all-female lines of melon with genotype AAgg, conventional sexual hybridization and backcross breeding methods were adopted, supplemented by molecular marker selection of g gene.
[0100] 1. Parent selection
[0101] Melon B15 (a litter of monkeys, Zhengzhou Xingyuan Seed Industry Co., Ltd.), hermaphrodite flower material, genotype is aagg, providing g gene; B8 (crown horn, Jingyan Yinong (Beijing) Seed Industry Technology Co., Ltd.), male flowers Hermaphrodite flower material, genotype is aaGG, reincarnation parent; B24 (Huangzi Jinyu, Hefei Pangzi Agricultural Products Co., Ltd.), monoecious (unisexual flower) material, genotype is AaGG, and A gene is provided.
[0102] 2. The all-female line breeding method with muskmelon B8 as the genetic background
[0103] Firstly, F 1 Generation seeds, planted F 1 For the generation plant, pull out the ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com