A kind of alcohol dehydrogenase mutant and its coding gene and application
A technology of alcohol dehydrogenase and mutants, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of expensive coenzymes, etc., and achieve the effects of high reaction conversion rate, good application prospects, simple and mild reaction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Embodiment 1: the establishment of wild-type alcohol dehydrogenase genetically engineered bacteria
[0022] According to the lactic acid bacteria Lactobacillus alcohol dehydrogenase wild-type gene sequence (GenBank: AY267012.1) included in NCBI, the whole gene fragment was artificially synthesized after sequence optimization, and the fragment was expanded by PCR amplification (adding BamHI and Hind III endonucleases on both sides of the fragment) gene fragment), its nucleotide sequence is shown in SEQ ID NO.1. And the gene was inserted into the pET30a plasmid by using the BamHI and Hind III endonuclease sites, and the ligated vector was transferred into Escherichia coli BL21 (DE3) to establish the alcohol dehydrogenase genetically engineered bacteria. The primers used for PCR amplification of alcohol dehydrogenase gene are:
[0023] F': CGCGGATCCATGACTGATCGTTTAAAAGG (SEQ ID NO. 4)
[0024] R': CCCAAGCTTTTATTGAGCAGTGTATCCAC (SEQ ID NO. 5)
Embodiment 2
[0025] Embodiment 2 Obtaining of Alcohol Dehydrogenase Mutant Gene
[0026] In this study, protein engineering of alcohol dehydrogenase was carried out by using error-prone PCR random mutation method. Error-prone PCR is to adjust the reaction conditions when using DNA polymerase to amplify the target gene, such as increasing the concentration of magnesium ions, adding manganese ions, changing the concentration of four kinds of dNTPs in the system, or using low-fidelity DNA polymerase, etc. To change the mutation frequency during the amplification process, so as to randomly introduce mutations into the target gene at a certain frequency, and obtain random mutants of protein molecules.
[0027] In this study, the principle that the lower Taq polymerase is easy to incorporate random mutations into the amplification product under specific measures, and at the same time, the Mn 2+ Alternative to natural cofactor Mg 2+ increase the probability of error.
[0028] The 50 μL PCR sys...
Embodiment 3
[0039] Example 3: Production of Alcohol Dehydrogenase - Shake Flask Protocol
[0040]Inoculate a single microbial colony of Escherichia coli containing a plasmid encoding target alcohol dehydrogenase into 100 mL of LB medium containing kanamycin (50 μg / mL) (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L , pH7.2). E. coli was grown in a shaker at 37° C. with shaking at 250 rpm for 4 hours. The transfer ratio is 1:200, put 1mL of bacterial culture solution in 200mL of LB medium containing kanamycin, place shaking culture under the same conditions, and regularly measure the absorbance value of the bacterial solution at 600nm to monitor the growth of the bacterial cells density. When the OD600 of the culture was 0.6 to 0.8, the expression of the alcohol dehydrogenase gene was induced by adding isopropyl βD-thiogalactopyranoside (IPTG) to a final concentration of 0.4 mM, and then the culture was continued overnight (at least 16 hours) . Cells were collected by centrifugation ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com