Molecular marker influencing duroc eye muscle area characters and application
A technology of molecular markers and pig eye muscles, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inaccurate and difficult positioning, achieve important economic benefits, speed up the breeding process, and improve The effect of eye muscle production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1 is to specifically explain the inventive process of obtaining the eye muscle area in the present invention.
[0028] Phenotypic data collection: Eye muscle area The area of the longissimus dorsi cross-section at the pig's last rib was determined using a planimeter. Eye muscle area = eye muscle height (cm) × eye muscle width (cm) × 0.7. The above experiment was carried out in the East China Breeding Breeding Farm of Guangdong Wens Food Group Co., Ltd. All Duroc pigs were kept in a stall with a size of 2.1m×0.7m×1.1m in length×width×height, and had free access to drinking water. And according to the unified feeding standard, unified diet feeding, regular quantitative feeding.
Embodiment 2
[0029] Example 2 is to specifically explain the inventive process of obtaining the gene marker in the present invention.
[0030] (1) Tissue DNA extraction and quality control: the ear tissue of the Duroc sow in the above-mentioned Example 1 was collected, soaked in 75% ethanol in time and placed in a -20°C refrigerator for later use. The whole genome DNA of Duroc sows was extracted according to the phenol-chloroform method, and the concentration and quality of the DNA of Duroc sows were determined by Nanodrop-ND1000 nucleic acid concentration instrument and agarose gel electrophoresis. Specifically, the A260 / 280 ratio measured by the nucleic acid concentration meter is 1.8-2.0, and the A260 / 230 ratio is 1.7-1.9. It is judged that the purity is qualified, and the concentration is higher than 300 ng / microliter. It is judged that the concentration is qualified; the purity and DNA samples with qualified concentrations were uniformly diluted to 50 ng / μl. Then 6 μl of the diluted ...
Embodiment 3
[0033] Embodiment 3 specifically explains the inventive process of the invention for detecting SNP markers.
[0034] (1) Amplification of the target fragment containing the SNP site significantly related to the eye muscle area of Duroc pig The target fragment is a 745bp nucleotide sequence in chromosome 6, and the upstream and downstream primers for sequence amplification are:
[0035] SEQ ID NO:2 upstream primer 5'-GGGGTTCCACACTCATATCCTC-3'
[0036] SEQ ID NO:3 downstream primer 5'—ATGGGTACAGGGGTGAGGTAT—3'
[0037] (2) PCR amplification system and condition setting: Configure a 30ul system, including 1ul of DNA sample, 0.9ul of upstream primer, 0.9ul of downstream primer, 15ul of PCR Mix, ddH 2 O 12.2ul; PCR conditions were set as pre-denaturation at 94°C for 2min, denaturation at 94°C for 30s, annealing at 57.5°C for 30s, extension at 72°C for 60s, a total of 38 cycles, and a final extension at 72°C for 10min.
[0038](3) DNA sequence sequencing detection: PCR products w...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com