Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker influencing duroc eye muscle area characters and application

A technology of molecular markers and pig eye muscles, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inaccurate and difficult positioning, achieve important economic benefits, speed up the breeding process, and improve The effect of eye muscle production

Active Publication Date: 2018-11-02
SOUTH CHINA AGRI UNIV
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two methods still have their own insurmountable defects.
The consistency test of QTL linkage analysis will be affected by different resource family groups, and a QTL region is very large, often including hundreds of candidate genes, it is difficult to fine-tune the QTL and find more adjacent linkage markers , and in gene mapping, due to the limitations of current mapping materials, there is often the problem of inaccurate mapping, and in the technology of QTL mapping of quantitative trait loci, not all target QTLs can be detected, and QTL There are problems such as interaction with the environment, and the masking of QTLs with large effects on QTLs with small effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker influencing duroc eye muscle area characters and application
  • Molecular marker influencing duroc eye muscle area characters and application
  • Molecular marker influencing duroc eye muscle area characters and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 is to specifically explain the inventive process of obtaining the eye muscle area in the present invention.

[0028] Phenotypic data collection: Eye muscle area The area of ​​the longissimus dorsi cross-section at the pig's last rib was determined using a planimeter. Eye muscle area = eye muscle height (cm) × eye muscle width (cm) × 0.7. The above experiment was carried out in the East China Breeding Breeding Farm of Guangdong Wens Food Group Co., Ltd. All Duroc pigs were kept in a stall with a size of 2.1m×0.7m×1.1m in length×width×height, and had free access to drinking water. And according to the unified feeding standard, unified diet feeding, regular quantitative feeding.

Embodiment 2

[0029] Example 2 is to specifically explain the inventive process of obtaining the gene marker in the present invention.

[0030] (1) Tissue DNA extraction and quality control: the ear tissue of the Duroc sow in the above-mentioned Example 1 was collected, soaked in 75% ethanol in time and placed in a -20°C refrigerator for later use. The whole genome DNA of Duroc sows was extracted according to the phenol-chloroform method, and the concentration and quality of the DNA of Duroc sows were determined by Nanodrop-ND1000 nucleic acid concentration instrument and agarose gel electrophoresis. Specifically, the A260 / 280 ratio measured by the nucleic acid concentration meter is 1.8-2.0, and the A260 / 230 ratio is 1.7-1.9. It is judged that the purity is qualified, and the concentration is higher than 300 ng / microliter. It is judged that the concentration is qualified; the purity and DNA samples with qualified concentrations were uniformly diluted to 50 ng / μl. Then 6 μl of the diluted ...

Embodiment 3

[0033] Embodiment 3 specifically explains the inventive process of the invention for detecting SNP markers.

[0034] (1) Amplification of the target fragment containing the SNP site significantly related to the eye muscle area of ​​Duroc pig The target fragment is a 745bp nucleotide sequence in chromosome 6, and the upstream and downstream primers for sequence amplification are:

[0035] SEQ ID NO:2 upstream primer 5'-GGGGTTCCACACTCATATCCTC-3'

[0036] SEQ ID NO:3 downstream primer 5'—ATGGGTACAGGGGTGAGGTAT—3'

[0037] (2) PCR amplification system and condition setting: Configure a 30ul system, including 1ul of DNA sample, 0.9ul of upstream primer, 0.9ul of downstream primer, 15ul of PCR Mix, ddH 2 O 12.2ul; PCR conditions were set as pre-denaturation at 94°C for 2min, denaturation at 94°C for 30s, annealing at 57.5°C for 30s, extension at 72°C for 60s, a total of 38 cycles, and a final extension at 72°C for 10min.

[0038](3) DNA sequence sequencing detection: PCR products w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of molecular marker-assisted selection and animal genetic breeding and discloses an SNP (Single Nucleotide Polymorphism) molecular marker influencing pig eye muscleareas and application thereof. The SNP molecular marker refers to site mutation of No. 35091111 base A-G of chromosome 6 of pig genome, and corresponds to 214bp (named as g.214T>G) in a sequence shown as SEQ ID NO:1. By utilizing the primer pair in the invention, PCR (Polymerase Chain Reaction) amplification is performed by taking pig genome DNA as a template, so that the SNP molecular marker inclose linkage with the pig eye muscle area character can be obtained. The molecular genetic marker provided by the invention can be used for screening eye muscle areas of pigs, and the eye muscle areaand meat quality traits of the pigs can be effectively improved.

Description

technical field [0001] The invention belongs to the field of molecular marker-assisted selection technology and animal genetic breeding, and in particular relates to a molecular marker affecting eye muscle area traits and its application. Background technique [0002] my country is the largest country in pork production and pork consumption in the world. In recent years, with the improvement of the total amount of pork and people's living standards, people's demand for high-quality pork is getting higher and higher. The eye muscle is also called the longissimus dorsi muscle. It is the most tender meat in the whole pig. It is rich in nutrition, delicious and easy to digest. Eye muscles are the representative of high-quality pork. Therefore, improving the yield of high-quality pork has become a new breeding goal, and eye muscle area, as the main factor affecting pork quality, has become a part of the pig breeding program. [0003] At present, 322 QTLs that are significantly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 杨杰吴珍芳王兴旺全建平郑恩琴杨明杨化强蔡更元
Owner SOUTH CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More