Winter squash EF1-alpha gene and application thereof

An Indian pumpkin, alpha gene technology, applied in the field of molecular biology, can solve problems such as unreported, and achieve the effects of improving detection efficiency, strong specificity, and improving reliability

Pending Publication Date: 2018-11-02
CROP RES INST OF FUJIAN ACAD OF AGRI SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cloning of the EF1-α gene of Indian pumpkin and the researc...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Winter squash EF1-alpha gene and application thereof
  • Winter squash EF1-alpha gene and application thereof
  • Winter squash EF1-alpha gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Obtaining of internal reference genes

[0020] According to the results of Illumina high-throughput deep sequencing of Indian pumpkin fruit transcriptome by our research group, the full-length cDNA of EF1-α gene was screened. After PCR amplification and sequencing verification, the full-length cDNA of the gene was 1701 bp, and the size of the open reading frame was 1344bp, the sequence is as follows:

[0021] GGGCTGCTTGCTACTGCGTAAAATTGAGGCTGCTTCTTTCTTCTCATTTCTCTGCAAATTCTTGTGGGCTCATTTGGTTAATATCAA ATG GGTAAGGAAAAGATTCATATTAACATCGTGGTTATTGGCCATGTCGACTCTGGAAAGTCGACCACCACCGGTCATCTTATCTACAAGCTTGGTGGAATTGACAAGCGTGTGATCGAGAGATTCGAGAAGGAAGCTGCTGAGATGAACAAAAGGTCATTCAAGTATGCTTGGGTGCTCGACAAACTTAAGGCAGAGCGTGAACGTGGTATTACCATTGACATTGCTCTGTGGAAGTTTGAGACCACCAAGTACTACTGCACAGTCATCGATGCCCCCGGACATCGTGACTTTATCAAGAACATGATTACTGGAACCTCTCAGGCTGATTGTGCCGTCCTCATCATTGACTCGACCACTGGTGGTTTTGAAGCTGGTATTTCCAAGGATGGTCAAACCCGTGAGCACGCTCTCCTTGCTTTCACCCTTGGTGTCAAGCAAATGATCTGCTGCTGTAACAAGATGGATGCC...

Embodiment 2

[0022] Example 2 Real-time fluorescent quantitative PCR design and routine PCR detection

[0023]Based on the nucleotide sequence of the Indian pumpkin internal reference gene EF1-α obtained in Example 1, and following the principle of real-time fluorescent quantitative PCR primer design, a pair of fluorescent quantitative specific primers were designed, and the amplified fragment was 211 bp. The fluorescent quantitative specific primers are the real-time fluorescent quantitative PCR primers (as shown in SEQ ID NOs: 2 and 3): forward primer 5'-ACGGTGATGCTGGTATGGTTA-3', reverse primer 5'-CATTGTTGTTGGTTGGCTTATT-3'.

[0024] Extract the total RNA of Indian pumpkin, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template and real-time fluorescent quantitative PCR primers as primer pairs for PCR Amplification, and the reaction system and re...

Embodiment 3

[0028] Example 3 Real-time fluorescent quantitative PCR primer verification

[0029] Total RNA was extracted from Indian squash, and the first strand of cDNA was synthesized according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, the RNA was reverse transcribed into cDNA; then the obtained cDNA was used as a template, followed by Power SYBR® Green PCR Master Mix instructions in ABI7500 The PCR reaction was carried out on the real-time quantitative PCR instrument, and the reaction system and reaction procedure of the PCR reaction were as follows:

[0030] The reaction system is: the total volume of the reaction system is 25 μL, 12.5 μL Power SYBR® Green PCR MasterMix, 1 μL template, 0.5 μL of the forward primer of the real-time fluorescence quantitative PCR primer in Example 2 (concentration is 10 μmol / L), implement The reverse primer of the real-time fluorescent quantitative PCR primer in Example 2 was 0.5 μL (concentration: 10 μmol / L), and distilled w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of molecular biology and in particular relates to a winter squash EF1-alpha gene and application thereof. The winter squash EF1-alpha gene has a nucleotide sequenceas shown in SEQ ID No.1. Winter squash real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers designed according to the gene sequence are shown in SEQ ID No.2 and SEQ ID No.3. Thereal-time fluorescent quantitative PCR primers designed by the invention are good in specificity and very high in stability, reliability and repeatability. Tests show that the winter squash EF1-alphagene can be stably expressed in different tissues at different phases under different abiotic stress conditions, and is suitable for being used as a reference gene in winter squash gene expression research.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to an elongation factor 1-alpha (EF1-α) gene that can be stably expressed in different tissues, different periods and various abiotic stress conditions of Indian pumpkin and its use as an internal reference gene application. Background technique [0002] pumpkin( Cucurbita .L, 2n=2x=40) is an important economic crop worldwide, widely distributed all over the world, and its pulp and seeds are edible. Pumpkin pulp is rich in vitamins, energy and various trace elements, and some pumpkin seeds have high oil content and have excellent health care effects on the human body. Pumpkin has rich nutritional value, especially some varieties contain higher carotene, vitamins and starch, and belongs to the bulk cultivated vegetables in the world. The genus Cucurbita contains some important cultivars, among which the three cultivars of Chinese squash, American squash and In...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/166
Inventor 朱海生刘建汀温庆放温文旭李永平王彬陈敏氡林珲叶新如张前荣
Owner CROP RES INST OF FUJIAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap