Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Marker for assisting epilepsy diagnosis and detection kit of marker

A kit and marker technology, applied in the field of markers for assisting epilepsy diagnosis and detection kits thereof, can solve the problem of lack of epilepsy diagnostic markers and other problems

Pending Publication Date: 2018-07-13
THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] 3. Cryptogenic epilepsy
[0015] 2. Simple partial seizures
[0017] 3. Complex partial seizures
[0030] Early diagnosis and early treatment is an effective way to prevent and treat epilepsy, but there is currently a lack of markers related to the diagnosis of epilepsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marker for assisting epilepsy diagnosis and detection kit of marker
  • Marker for assisting epilepsy diagnosis and detection kit of marker
  • Marker for assisting epilepsy diagnosis and detection kit of marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1 Detection of ERBB4 mutation in a family with epilepsy

[0064] 1.1 Subjects: The proband of Tu's epilepsy family and its family members from Fuling area of ​​Chongqing, the genetic map of the family is as follows figure 1 As shown, the test objects include 2 epilepsy patients (member number 13 in the figure), and 1 normal family member (member number 2 in the figure); number 1 and 3: generalized tonic-clonic seizures; number 2: no disease. A detailed physical examination was performed on all family members No. 1-3, and blood samples were collected from each person after signing the informed consent.

[0065] 1.2 Sequencing:

[0066] The collected blood samples were sent to Beijing Mikino Gene Technology Co., Ltd. for sequencing for epilepsy gene mutation screening and verification, and the relationship between clinical phenotype and genotype was analyzed. The results are as follows:

[0067] Align the measured sequence with the normal ERBB4 standard sequence (https:...

Embodiment 2

[0073] This embodiment provides a kit for detecting the ERBB4 1972 site mutation, which includes: a primer for detecting whether the ERBB41972 site has a mutation A1972T, a forward primer: TTCACAAGCTTTGTTTAACGGAC, a reverse primer: TGTGGATAATGTCTTGTACAACTGC; and a PCR amplification reagent: 10×Buffer (containing 15mM Mg 2+ ), dNTP (2.5Mm), high-fidelity DNA polymerase pfu DNA polymerase (5U / μl) and ddH 2 O.

[0074] The method for detecting whether the mutation A>T occurs at the 1972nd position of ERBB4 by using the kit mainly includes the following steps:

[0075] (1) Extract sample DNA and use it as a template to perform PCR reaction using the above-mentioned PCR reaction kit.

[0076] (2) Detection of multiple PCR products: Electrophoresis was performed on the PCR amplification products with agarose gel to detect whether the PCR amplification was successful, and the size of the amplified fragment was 379 bp.

[0077] (3) The PCR product is directly sequenced, and the seq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a marker for assisting epilepsy diagnosis and a detection kit of the marker, and relates to the field of the epilepsy diagnosis. Research for detecting an ERBB4 gene of membersof an epilepsy family discovers that the ERBB4 gene of the members suffering from epilepsy in the family has mutant c.A1972T; the gene mutation results in variation of 658th amino acid of the corresponding ERBB4 gene protein from isoleucine (I) to phenylalanine (F), and the variation is missense mutation; nucleic acid molecules containing the mutant c.A1972T or protein containing mutant p.I658F can be used as a biomarker for the epilepsy diagnosis, and a quick and reliable detection auxiliary marker is provided for the epilepsy diagnosis in molecular level.

Description

technical field [0001] The present invention relates to the field of epilepsy diagnosis, in particular to a marker for assisting epilepsy diagnosis and a detection kit thereof. Background technique [0002] Epilepsy is a syndrome of chronic recurrent transient brain dysfunction. It is characterized by recurrent epileptic seizures caused by highly synchronized abnormal discharge of brain neurons. Epilepsy is one of the common diseases of the nervous system, second only to stroke in prevalence. The incidence of epilepsy is age-related. It is generally believed that the prevalence rate is the highest within 1 year of age, and gradually decreases after 1 to 10 years of age. The ratio of male to female patients with epilepsy in my country is (1.15-1.7):1. [0003] The etiology of epilepsy is extremely complex and can be divided into three categories, and there are many factors that affect the onset: [0004] 1. Idiopathic epilepsy [0005] Suspicious genetic predisposition ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C07K14/71C12N15/12C40B40/06
CPCC07K14/71C12Q1/6883C12Q2600/156
Inventor 田鑫王学峰王唯阳勇肖飞马远林张海清徐祖才王静郭毅
Owner THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com