Method for constructing ompA gene-deleted riemrellaanatipestifer CH3 attenuated strain
A technology of Riemerella anatipestifer and a construction method, which is applied in the field of construction of a Riemerella anatipestifer CH3 attenuated strain lacking the ompA gene, can solve the problem that the total amino acid transport rate is decreased, the coverage of the virus strain is incomplete, and the complete protection cannot be provided. Injection absorption and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0119] The first step: preparation of Riemerella anatipestifer CH3 attenuated strain:
[0120] OmpA, as an adhesin or invasin, is related to the virulence of bacteria. Hu et al. obtained the ompA gene deletion strain Th4ΔompA of the serotype 2 Riemerella anatipestifer Th4 strain through homologous recombination. The results of the study showed that the virulence of the Th4ΔompA strain significantly lower than that of the parental strain Th4, and the adhesion and invasion ability to Vero cells was also significantly lower than that of the parental strain Th4, indicating that OmpA is a very important virulence factor in Riemerella anatipestifer, and may be an adhesion factor ;
[0121] Step 2: Construction of R. anatipestifer CH3 mutant strain, design primers according to ompA upstream and downstream homology arms of R. anatipestifer CH3 whose gene function has been determined
[0122] ompA-L F: TTGGATCCTGTATTTCAATGATTGGTATAGTAATT
[0123] ompA-L R: CTTGGCCATCCAATTCTCTTATTATCA...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com