Supercharge Your Innovation With Domain-Expert AI Agents!

Marker assisting epilepsy diagnosis and detection kit of marker

A kit and marker technology, which can be used in biological testing, disease diagnosis, microbial determination/examination, etc., and can solve the problem of lack of epilepsy diagnostic markers.

Active Publication Date: 2018-06-22
THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] 3. Cryptogenic epilepsy
[0015] 2. Simple partial seizures
[0017] 3. Complex partial seizures
[0030] Early diagnosis and early treatment is an effective way to prevent and treat epilepsy, but there is currently a lack of markers related to the diagnosis of epilepsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marker assisting epilepsy diagnosis and detection kit of marker
  • Marker assisting epilepsy diagnosis and detection kit of marker
  • Marker assisting epilepsy diagnosis and detection kit of marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1 Detection of FASN mutation in a family with epilepsy

[0064] 1.1 Subjects: The proband and family members of Huang's epilepsy family from Jiangjin District, Chongqing City. The genetic map of the family is as follows: figure 1 As shown, the test objects include 2 epilepsy patients (member 1 and 3 in the figure), and 1 normal family member (member 2 in the figure); No. 1 and No. 3: generalized tonic-clonic seizures; No. 2: no epilepsy sick. A detailed physical examination was performed on all family members No. 1-3, and blood samples were collected from each person after signing the informed consent.

[0065] 1.2 Sequencing:

[0066] The collected blood samples were sent to Beijing Mikino Gene Technology Co., Ltd. for sequencing for epilepsy gene mutation screening and verification, and the relationship between clinical phenotype and genotype was analyzed. The results are as follows:

[0067] The measured sequence was compared with the normal FASN standard sequence...

Embodiment 2

[0073] This embodiment provides a kit for detecting the FASN 2998th site mutation, which includes: a primer for detecting whether the FASN2998 site has a mutation G2998A, a forward primer: AAGCTGCATGCCTAGCTGTG, a reverse primer: GAACGGCAACCTGGTAGTGAG; and a PCR amplification reagent: 10×Buffer (containing 15mM Mg 2+ ), dNTP (2.5Mm), high-fidelity DNA polymerase pfu DNA polymerase (5U / μl) and ddH 2 O.

[0074] The method for detecting whether the mutation G>A occurs at the 2998th position of FASN by using the kit mainly includes the following steps:

[0075] (1) Extract sample DNA and use it as a template to perform PCR reaction using the above-mentioned PCR reaction kit.

[0076] (2) Detection of multiple PCR products: electrophoresis was performed on the PCR amplification products with agarose gel to detect whether the PCR amplification was successful, and the length of the amplification was 385 bp.

[0077] (3) The PCR product is directly sequenced, and the sequence resul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a marker assisting epilepsy diagnosis and a detection kit of the marker, and relates to the field of epilepsy diagnosis. According to the research, it is found from detection on an FASN gene of a member of an epilepsy family patient that the FASN gene of the member of the epilepsy family patient has a mutation c.G2998A, the gene mutation causes that the 1,000 amino acidof the corresponding FASN protein mutates into asparagine (N) from aspartic acid (D) and is a missense mutation. An nucleic acid molecule containing the c.G2998A mutation or protein containing a mutation p.D1000N can both serve as a biomarker of epilepsy diagnosis, and the rapid and reliable detection assistance marker is provided for epilepsy diagnosis on the molecular level.

Description

technical field [0001] The present invention relates to the field of epilepsy diagnosis, in particular to a marker for assisting epilepsy diagnosis and a detection kit thereof. Background technique [0002] Epilepsy is a syndrome of chronic recurrent transient brain dysfunction. It is characterized by recurrent epileptic seizures caused by highly synchronized abnormal discharge of brain neurons. Epilepsy is one of the common diseases of the nervous system, second only to stroke in prevalence. The incidence of epilepsy is age-related. It is generally believed that the prevalence rate is the highest within 1 year of age, and gradually decreases after 1 to 10 years of age. The ratio of male to female patients with epilepsy in my country is (1.15-1.7):1. [0003] The etiology of epilepsy is extremely complex and can be divided into three categories, and there are many factors that affect the onset: [0004] 1. Idiopathic epilepsy [0005] Suspicious genetic predisposition ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883G01N33/68
CPCC12Q1/6883C12Q2600/156G01N33/6893G01N2333/91057G01N2800/2857
Inventor 田鑫王学峰王唯肖飞马远林张海清胡以达朱炳林徐祖才王静李凤
Owner THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More