Supercharge Your Innovation With Domain-Expert AI Agents!

Tobacco nitrate reductase NIA1 promoter and expression vector and application thereof

A reductase and promoter technology, applied in the field of molecular biology, to achieve broad application space and market prospects, save nitrogen fertilizer consumption, and improve plant nitrogen efficiency

Active Publication Date: 2018-05-08
HENAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, it is not yet clear what acts on the promoter region of the NIA gene Signal response components, urgent research NIA The promoter regulatory element of the gene and the presence or absence signal response element, for further verification its The research on the signal response function lays the foundation, which is of great significance for improving plant nitrogen efficiency, saving nitrogen fertilizer consumption, and developing resource-saving and environment-friendly agriculture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco nitrate reductase NIA1 promoter and expression vector and application thereof
  • Tobacco nitrate reductase NIA1 promoter and expression vector and application thereof
  • Tobacco nitrate reductase NIA1 promoter and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Obtaining a promoter fragment

[0044] Find key enzymes of tobacco nitrogen metabolism in NCBI database NIA1 The ATG upstream sequence of the gene intercepts the 937bp base sequence. For the specific sequence, see SEQ ID NO.1. Design primers, use the tobacco genome as a template, and obtain a fragment by PCR amplification technology. The primer sequence of the amplified fragment:

[0045] The upstream primer is NIA1-F: TATATATATGACCCTGCAATGAAAG;

[0046] The downstream primer is NIA1-R: AGATTATTCTAAAAAAGAAAGAGAGAT;

[0047] Result: see figure 1 , After obtaining the 937bp target fragment, connect the vector by TA cloning, sequence and compare, and it is consistent with the corresponding base sequence in the sequence recorded in the database.

Embodiment 2

[0048] Example 2: Promoter Acquisition of modified fragments of signal response elements

[0049] According to the inventor's previous research and prediction, a possible Signal response element, the sequence is: GACCCTACGGGCGTAAAAAG, the element is in NIA1 The position in the gene promoter is -281bp~-262bp.

[0050] Modify the element, such as figure 2 As shown, the promoters for deleting this element and the promoters for doubling (4-fold) this element were respectively constructed, tobacco nitrate reductase NIA1 Promoter, possible The schematic diagram of the construction of the recombinant vector for the modified promoter of the signal response element is shown in Fig. 3 .

[0051] When amplifying the modified promoter, the upstream and downstream primers are the same as those used in Example 1.

[0052] Results: After obtaining the target fragment of the deleted and doubled promoter, the vector was connected by TA cloning, sequenced and compared, and it was cons...

Embodiment 3

[0053] Embodiment 3: Construction of promoter recombinant expression vector

[0054] (1) Use the pCAMBIA-NPT-GUS vector with Eco RI / Hind After Ⅲ enzyme digestion, cut off the 35S promoter, and recover the large fragment for later use;

[0055] (2) The promoter sequences on various T vectors sequenced correctly in Example 1 and Example 2 were used Eco RI / Hind After Ⅲ digestion, recovery and purification, the target fragment was ligated into the digested pCAMBIA-NPT-GUS vector with T4 DNA ligase;

[0056] (3) Transform the ligation product into Escherichia coli E. coli In the DH5α competent state, positive recombinants were identified by colony PCR method, so that NIA1 The promoter is fused with the GUS gene;

[0057] (4) Perform PCR identification on the recombinant plasmid, and after confirming that the sequence size is correct, extract the plasmid for later use and obtain expression GUS The plant recombinant expression vector pCAMBIA-NPT-NIA1–P-GUS of the gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco nitrate reductase NIA1 promoter and an expression vector and application thereof. The nucleotide sequence of the NIA1 promoter is the sequence shown in SEQ ID NO.1, or the key element which is highly similar to the sequence of a nitrate signal response element, wherein the NIA1 expression of the key element is removed or doubly regulated on the basis of retainingthe core promoter sequence of the sequence shown in the SEQ ID NO.1, or the nucleic acid sequence with equivalent functions derived from the sequence shown in the SEQ ID NO.1. The eukaryotic expression vector with the NIA1 promoter sequence is used for plant genetic transformation. Engineering bacteria with the NIA1 promoter sequence used for the plant genetic transformation is provided. The application of the NIA1 promoter in the initiation of a target gene expression is disclosed, and the target gene is a GUS gene. According to the tobacco nitrate reductase NIA1 promoter and the expression vector and application thereof, a foundation for verification of the NIA1 promoter nitric acid signal response function research is laid, and the tobacco nitrate reductase NIA1 promoter and the expression vector have broad prospects in improving nitrogen efficiency of plants, saving nitrogen fertilizer using amount, and developing resource-saving and environmentally-friendly agriculture.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a tobacco nitrate reductase NIA1 Promoter, its expression vector and its application. Background technique [0002] Nitrate nitrogen and ammonium nitrogen are two main nitrogen sources for crops, among which nitrate nitrogen can induce and regulate the expression of more than 1000 genes, which are involved in many important functions such as pentose phosphate oxidation, glycolysis, amino acid metabolism, etc. physiological pathway. Therefore, the absorption and utilization of nitrate nitrogen by plants is an important factor affecting plant yield and nitrogen use efficiency. Due to the constant change of external nitrogen nutrition, plants need to constantly adjust their own growth and metabolic process in order to adapt to the fluctuation of available nitrogen nutrients. During this regulation process, nitrate ( ) is a key signaling molecule for plants to sense ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N1/21A01H5/00A01H6/82
CPCC12N9/0044C12N15/8238C12Y107/99004
Inventor 杨惠娟王景史宏志周炎张玉宁赵莉
Owner HENAN AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More