Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

tobacco nitrate reductase nia1 Promoter, its expression vector and its application

A technology of eukaryotic expression vector and reductase, which is applied in the field of molecular biology to achieve the effect of improving plant nitrogen efficiency

Active Publication Date: 2021-07-13
HENAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, it is not yet clear what acts on the promoter region of the NIA gene Signal response components, urgent research NIA The promoter regulatory element of the gene and the presence or absence signal response element, for further verification its The research on the signal response function lays the foundation, which is of great significance for improving plant nitrogen efficiency, saving nitrogen fertilizer consumption, and developing resource-saving and environment-friendly agriculture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • tobacco nitrate reductase <i>nia1</i> Promoter, its expression vector and its application
  • tobacco nitrate reductase <i>nia1</i> Promoter, its expression vector and its application
  • tobacco nitrate reductase <i>nia1</i> Promoter, its expression vector and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Obtaining a promoter fragment

[0044] Find key enzymes of tobacco nitrogen metabolism in NCBI database NIA1 The ATG upstream sequence of the gene intercepts the 937bp base sequence. For the specific sequence, see SEQ ID NO.1. Design primers, use the tobacco genome as a template, and obtain a fragment by PCR amplification technology. The primer sequence of the amplified fragment:

[0045] The upstream primer is NIA1-F: TATATATATGACCCTGCAATGAAAG;

[0046] The downstream primer is NIA1-R: AGATTATTCTAAAAAAGAAAGAGAGAT;

[0047] Result: see figure 1 , After obtaining the 937bp target fragment, connect the vector by TA cloning, sequence and compare, and it is consistent with the corresponding base sequence in the sequence recorded in the database.

Embodiment 2

[0048] Example 2: Promoter Acquisition of modified fragments of signal response elements

[0049] According to the inventor's previous research and prediction, a possible Signal response element, the sequence is: GACCCTACGGGCGTAAAAAG, the element is in NIA1 The position in the gene promoter is -281bp~-262bp.

[0050] Modify the element, such as figure 2 As shown, the promoters for deleting this element and the promoters for doubling (4-fold) this element were respectively constructed, tobacco nitrate reductase NIA1 Promoter, possible The schematic diagram of the construction of the recombinant vector for the modified promoter of the signal response element is shown in Fig. 3 .

[0051] When amplifying the modified promoter, the upstream and downstream primers are the same as those used in Example 1.

[0052] Results: After obtaining the target fragment of the deleted and doubled promoter, the vector was connected by TA cloning, sequenced and compared, and it was cons...

Embodiment 3

[0053] Embodiment 3: Construction of promoter recombinant expression vector

[0054] (1) Use the pCAMBIA-NPT-GUS vector with Eco RI / Hind After Ⅲ enzyme digestion, cut off the 35S promoter, and recover the large fragment for later use;

[0055] (2) The promoter sequences on various T vectors sequenced correctly in Example 1 and Example 2 were used Eco RI / Hind After Ⅲ digestion, recovery and purification, the target fragment was ligated into the digested pCAMBIA-NPT-GUS vector with T4 DNA ligase;

[0056] (3) Transform the ligation product into Escherichia coli E. coli In the DH5α competent state, positive recombinants were identified by colony PCR method, so that NIA1 The promoter is fused with the GUS gene;

[0057] (4) Perform PCR identification on the recombinant plasmid, and after confirming that the sequence size is correct, extract the plasmid for later use and obtain expression GUS The plant recombinant expression vector pCAMBIA-NPT-NIA1–P-GUS of the gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco nitrate reductase NIA1 Promoter, its expression vector and its application. Should NIA1 The nucleotide sequence of the promoter is: the sequence shown in SEQ ID NO.1; or on the basis of retaining the core promoter sequence shown in SEQ ID NO.1, the regulation is removed or doubled NIA1 An expressed key element highly similar to the signal response element sequence; or a nucleic acid sequence with equivalent functions derived from the sequence shown in SEQ ID NO.1. a kind of NIA1 Eukaryotic expression vectors for plant genetic transformation with promoter sequences. a kind of NIA1 The engineering bacteria used for plant genetic transformation of the promoter sequence. NIA1 The application of the promoter in promoting the expression of the target gene, the target gene is GUS Gene. The invention is to verify NIA1 The research on the response function of promoter nitric acid signal has laid a foundation and has broad prospects for improving plant nitrogen efficiency, saving nitrogen fertilizer consumption and developing resource-saving and environment-friendly agriculture.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a tobacco nitrate reductase NIA1 Promoter, its expression vector and its application. Background technique [0002] Nitrate nitrogen and ammonium nitrogen are two main nitrogen sources for crops, among which nitrate nitrogen can induce and regulate the expression of more than 1000 genes, which are involved in many important functions such as pentose phosphate oxidation, glycolysis, amino acid metabolism, etc. physiological pathway. Therefore, the absorption and utilization of nitrate nitrogen by plants is an important factor affecting plant yield and nitrogen use efficiency. Due to the constant change of external nitrogen nutrition, plants need to constantly adjust their own growth and metabolic process in order to adapt to the fluctuation of available nitrogen nutrients. During this regulation process, nitrate ( ) is a key signaling molecule for plants to sense ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N1/21A01H5/00A01H5/10A01H6/82
CPCC12N9/0044C12N15/8238C12Y107/99004
Inventor 杨惠娟王景史宏志周炎张玉宁赵莉
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com