Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of preparation method of ursodeoxycholic acid and its preparation enzyme 2

A technology of ursodeoxycholic acid and cholan acid, applied in the field of β-steroid dehydrogenase, which can solve the problems of organic solvent residue, long reaction time, and environmental pollution

Active Publication Date: 2021-07-06
BONTAC INST OF GREEN BIOCATALYSIS
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a new preparation method of ursodeoxycholic acid, to solve the problems of organic solvent residue, harsh conditions, long reaction time, cumbersome operation and pollution in the existing preparation method mentioned in the above-mentioned background technology. environment and other disadvantages, the present invention also provides a biological enzyme suitable for the new preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of preparation method of ursodeoxycholic acid and its preparation enzyme 2
  • A kind of preparation method of ursodeoxycholic acid and its preparation enzyme 2
  • A kind of preparation method of ursodeoxycholic acid and its preparation enzyme 2

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0025] The specific implementation process of the preparation method of ursodeoxycholic acid provided by the invention is as follows:

[0026] Suspend 3α-hydroxy-7oxo-5β-cholanic acid in 50-100mM potassium phosphate buffer (pH8.0), adjust the pH to 8.0 with 10M NaOH, and then add the final concentration of 30-50mg / mL Glucose and use 10M NaOH to adjust the pH to 7.8-8.0, add 7β-steroid dehydrogenase and glucose dehydrogenase, and finally add NADP with a final concentration of 0.01-0.25 mg / mL, and the final concentration of the substrate is 50-100 mg / mL. The reaction is carried out at a temperature of 25-35° C., 200-400 rpm and a pH of 7.5-8.5, and the reaction time is 8-15 hours. Take the reaction solution at regular intervals and dilute it 50-100 times with the mobile phase, and inject samples for liquid phase analysis after microporous filtration. For liquid phase detection, use Phenomenx Gemini 5μmNX-C18 110A 250×4.6mm as the analytical column, and the mobile phase is aceto...

Embodiment 1

[0029] Preparation of co-expression recombinant plasmid pET22b-BHSDH5-GDH containing parental gene

[0030]The 7β-steroid dehydrogenase gene BHSDH5 derived from Enterococcus silesiacus and the glucose dehydrogenase gene GDH derived from Bacillus megaterium were respectively used with the primer pair 5'CGCCATATGATGTATACAGATTTAAAAGA3' and 5'CCGGAATTCTTAGCCTCTTCCCGTTTGGA3' and the primer 5'CCGGAATTCAAGGAGATATACATATGATGTATACAGATTTAAAAGA3' and 5'CCGCTCGAGTTAGCTCTTCCCGTTTGGA3' were amplified by PCR to obtain the PCR product and then inserted into the Nde I and EcoR I sites, EcoR I site and Xho I site of the expression vector pET22b(+) point, the co-expression recombinant plasmid pET22b-BHSDH5-GDH was obtained. Through DNA sequencing, it is determined that the nucleotide sequence of the cloned parent 7β-steroid dehydrogenase is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2; it is determined that the cloned parent glucose dehydrogenase The nucleotide seq...

Embodiment 2

[0032] Preparation of co-expression recombinant plasmids containing 7β-steroid dehydrogenase mutants

[0033] Perform site-directed mutation on the 7β-steroid dehydrogenase parent by reverse PCR technology, design reverse primers at the mutation position, use upstream and downstream mutation primers to amplify the target fragment, and introduce corresponding mutations on the primers to recombine plasmid pET22b-BHSDH5 -GDH was used as a template for inverse PCR, and the PCR product was transformed into Escherichia coli Rosetta (de3) after being digested with Dpn I enzyme, and colonies were picked and sent for sequencing after being screened by Amp. The mutation sites and primer design are shown in Table 1.

[0034] The PCR system is: TaKaRa EX Taq HS 0.25ul; 10×Ex Taq Buffer 5ul; template plasmid 1ul; dNTP (2.5mM each) 4ul; upstream primer 1ul; downstream primer 1ul; sterile water up to 50ul.

[0035] The PCR program is: first 98°C for 2min; then 98°C for 10s, 50-65°C for 30s,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing ursodeoxycholic acid by using biological enzyme catalysis technology and 7β-steroid dehydrogenase for preparation thereof. The method uses 3α-hydroxy-7 oxo-5β-cholanic acid as a substrate, and in the presence of NADP, glucose, glucose dehydrogenase and buffer solution, 3α-hydroxy-7 Preparation of ursodeoxycholic acid from oxo-5β-cholanic acid with 7β-steroid dehydrogenase from Enterococcus Enterococcus silesiacus . The method has the advantages of simple operation, mild and easy-to-control reaction conditions, short reaction time, a substrate conversion rate as high as 99.6%, and a product content of more than 98.5%.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a method for preparing ursodeoxycholic acid using a biological enzyme catalysis technology and 7β-steroid dehydrogenase for preparation thereof. Background technique [0002] Ursodeoxycholic acid is the main active ingredient of bear bile, a precious traditional Chinese medicine. It has the functions of increasing the secretion of bile acid, changing the composition of bile, helping the gradual dissolution of cholesterol in gallstones, and reducing cholesterol and cholesterol in bile. It is mainly used for Treat gallstone disease. As we all know, bear bile is a very scarce resource, because the traditional way of obtaining it mainly relies on the method of artificially breeding live bears to extract bile. At present, this traditional method with long period, low yield and inhumanity is gradually replaced by artificial synthesis method. [0003] At first, most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P33/02C12N9/04
CPCC12N9/0006C12P33/02C12Y101/01201C12P33/00
Inventor 刘立辉傅荣昭刘滔滔曹磊彭亭
Owner BONTAC INST OF GREEN BIOCATALYSIS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com