Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chicken luteinizing hormone releasing hormone recombinant antigen castrating vaccine and preparation method therefor

A luteinizing hormone and hormone-releasing technology, applied in the direction of luteinizing hormone-releasing hormone, vaccines, contraceptive vaccine components, etc., can solve problems such as chicken luteinizing hormone-releasing hormone recombinant antigen castration vaccines that have no effect, and achieve castration Good effect, avoid trouble, good stability effect

Inactive Publication Date: 2018-04-06
SICHUAN HUAPAI BIO PHARMA
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] But now there is no report of chicken luteinizing hormone releasing hormone recombinant antigen castration vaccine with better effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken luteinizing hormone releasing hormone recombinant antigen castrating vaccine and preparation method therefor
  • Chicken luteinizing hormone releasing hormone recombinant antigen castrating vaccine and preparation method therefor
  • Chicken luteinizing hormone releasing hormone recombinant antigen castrating vaccine and preparation method therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Construction of cLHRH-RA-RS1 strain recombinant expression plasmid

[0030] 1. Design and artificial synthesis of cLHRH gene

[0031] The design of gene fragments is based on the amino acid sequence of chicken luteinizing hormone releasing hormone (cLHRH) and the corresponding Escherichia coli preferred codons, and two complementary cLHRH gene sequences are designed in combination with the characteristics of the pET-32c plasmid itself. Under the premise of ensuring that the reading frame is correct after inserting the vector, add two restriction sites, Ncol and Xhol, at the 5' end and 3' end respectively, and add two protective bases before the restriction site, and use DNA automatic The synthesizer synthesizes the gene, and the gene sequence is as follows:

[0032] P1:5'-GGCCATGGCTGAACACTGGTCCTACGGTCTGCGTCCGAACGGCGGTGAGCACTGGTCTTACGGCCTGCAGCCGGGTGGCGGTGAACATTGGTCTTACGGTCTGCGCCCGAACTAATGAACTCGAGCA-3' (SEQ ID NO: 1)

[0033] P2:5'-TGCTCGAGTTCATTAGTTCGGGCGCAGA...

Embodiment 2

[0047] Embodiment 2 prepares original bacterial liquid

[0048] According to the protein expression characteristics and the immunogenicity of the expressed protein, the original strains used for the development of chicken luteinizing hormone releasing hormone recombinant antigen castration vaccine were screened, and the specific process was as follows:

[0049] 1. Conversion

[0050] The cLHRH / pET-32c recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent bacteria, and at the same time, Escherichia coli was transformed with the pET-32c plasmid as a negative vector control. Take 200 μl of transformed bacteria liquid, smear it on LB agar plate containing Amp50 μg / ml, use untransformed competent bacteria as negative control, and culture at 37°C for 18 hours. Store at 2-8°C. After the colonies are picked and amplified and screened, the best colonies are selected to establish the original seed batch.

[0051] 2. Prepare the original bacterial liquid

[00...

Embodiment 3

[0053] The determination of embodiment 3 optimum inoculum amount

[0054] The original bacterial liquid obtained in Example 2 was inoculated into a 1000ml Erlenmeyer flask containing 250ml Amp-LB liquid medium, and the inoculation amounts were respectively 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% %, 5.0%, repeated three times under the same conditions, respectively, the first group, the second group, the third group, all cultured with shaking at 36-37°C and 230r / min. Record the growth curve of the bacterial culture, and take samples 1 hour and 2 hours after the culture, and measure the OD 600nm The results are shown in Table 1-3.

[0055] Table 1 Inoculum size and OD 600nm Value relations (first set)

[0056]

[0057] Table 2 Inoculum size and OD 600nm Value Relationships (Second Group)

[0058]

[0059] Table 3 Inoculum size and OD 600nm Value Relationships (Group 3)

[0060]

[0061] The experimental results show that when the inoculation amount of each...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a chicken luteinizing hormone releasing hormone recombinant antigen castrating vaccine and a preparation method therefor. The method comprises the steps: (1) designing a cLHRH gene; (2) subjecting a designed gene sequence to synthesis, annealing, enzyme digestion and connecting, and then, transferring the gene sequence into an Escherichia coli competent cell, so as to obtaina recombinant plasmid; (3) preparing an original bacterial solution; (4) carrying out lactose induction; (5) carrying out low-temperature osmotic shock separation and purification; (6) carrying out hydroformylation by adopting 10*hydroformylation brine; and (7) carrying out vaccine preparation. The preparation method is simple, the cost is low, the whole preparation process is free of any substance which is potentially toxic and harmful to animals or is difficult to degrade, and the prepared vaccine has a good castrating effect and is convenient to use and good in stability.

Description

technical field [0001] The invention belongs to the technical field of castration vaccines, in particular to a chicken luteinizing hormone releasing hormone recombinant antigen castration vaccine and a preparation method thereof. Background technique [0002] Luteinizing hormore releasing hormone (LHRH) is a decapeptide hormone secreted by the hypothalamus of animals, and its main biological function is to control the synthesis and secretion of luteinizing hormone (LH) and Follicle hormone (FSH), these hormones can promote the normal development of gonads and sex organs, and maintain the reproductive function of animals. Castration vaccine can immune regulate the level of sex-related hormones in animal endocrine system, inhibit the development of animal sex organs, make animals lose sexual behavior and sexual function, thereby preventing chaotic mating (causing herd degradation) and fighting, promoting animal growth, improving carcass composition and Improve meat quality, m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70A61K39/00A61P15/00
CPCA61K39/0006C07K7/23C07K2319/02
Inventor 何信群龚文波吉传义谢建勇杨建波李峰伏刚方鹏飞严成郝伟伟潘华柱扶海
Owner SICHUAN HUAPAI BIO PHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com