Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application
A porcine circovirus and detection reagent technology, applied in the field of virus PCR detection, can solve the problems of unclear incidence and epidemic situation, and detection reagents have not yet appeared, and achieve the effect of high sensitivity, strong specificity and accurate detection means
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Primers
[0034] The embodiment of the present invention provides a primer for specific detection of porcine circovirus type 3, the primer sequence is as follows:
[0035] Upstream primer: 5' CGGGAAATCTGACTGAAGTT 3'
[0036] Downstream primer: 5' ACTCCTCCGGTACAACATTA 3'.
Embodiment 2
[0037] Embodiment 2 PCR detection reagent
[0038] The embodiment of the present invention provides a PCR detection reagent for specific detection of porcine circovirus type 3, the reagent includes the following components: reaction mixture, water and primers for specific detection of porcine circovirus type 3; Wherein, the primer sequence is as follows:
[0039] Upstream primer: 5' CGGGAAATCTGACTGAAGTT 3'
[0040] Downstream primer: 5' ACTCCTCCGGTACAACATTA 3'.
[0041] Among them, the reaction mixture is 2xEasyTaq PCRSuperMix produced by Beijing Quanshijin Biotechnology Co., Ltd.; the water is RNase-free Water produced by TaKaRa Company.
Embodiment 3
[0042] Example 3 PCR kit
[0043] The embodiment of the present invention provides a PCR kit for preparing and detecting porcine circovirus type 3, specifically a kit containing the PCR detection reagent of Example 2.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com