Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application

A porcine circovirus and detection reagent technology, applied in the field of virus PCR detection, can solve the problems of unclear incidence and epidemic situation, and detection reagents have not yet appeared, and achieve the effect of high sensitivity, strong specificity and accurate detection means

Inactive Publication Date: 2018-03-23
SHANDONG NEW HOPE LIUHE GROUP
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the incidence and prevalence of PCV3 in pigs in my country is not clear, so there is no detection reagent that can quickly and accurately detect PCV3

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application
  • Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application
  • Primer for detecting porcine circovirus 3, PCR (polymerase chain reaction) kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Primers

[0034] The embodiment of the present invention provides a primer for specific detection of porcine circovirus type 3, the primer sequence is as follows:

[0035] Upstream primer: 5' CGGGAAATCTGACTGAAGTT 3'

[0036] Downstream primer: 5' ACTCCTCCGGTACAACATTA 3'.

Embodiment 2

[0037] Embodiment 2 PCR detection reagent

[0038] The embodiment of the present invention provides a PCR detection reagent for specific detection of porcine circovirus type 3, the reagent includes the following components: reaction mixture, water and primers for specific detection of porcine circovirus type 3; Wherein, the primer sequence is as follows:

[0039] Upstream primer: 5' CGGGAAATCTGACTGAAGTT 3'

[0040] Downstream primer: 5' ACTCCTCCGGTACAACATTA 3'.

[0041] Among them, the reaction mixture is 2xEasyTaq PCRSuperMix produced by Beijing Quanshijin Biotechnology Co., Ltd.; the water is RNase-free Water produced by TaKaRa Company.

Embodiment 3

[0042] Example 3 PCR kit

[0043] The embodiment of the present invention provides a PCR kit for preparing and detecting porcine circovirus type 3, specifically a kit containing the PCR detection reagent of Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting porcine circovirus 3, a PCR (polymerase chain reaction) kit and an application. The sequence of an upstream primer of the primer is 5' CGGGAAATCTGACTGAAGTT 3', and the sequence of a downstream primer of the primer is 5' ACTCCTCCGGTACAACATTA 3'. The primer has the advantages that the primer is a pair of specific primers designed for PCV3 (porcine circovirus 3) according to the sequence of the PCV3 in a GenBank, a method for rapidly and accurately detecting the PCV3 is built, strong in specificity, high in sensitivity and good in repeatability, anda rapid and accurate detection means is provided for laboratory diagnosis of the PCV3 and survey of the prevalence state of the PCV3 in Chinese swine herds.

Description

technical field [0001] The invention relates to the technical field of virus PCR detection, in particular to a specific primer for detecting porcine circovirus type 3, a PCR kit and an application thereof. Background technique [0002] Porcine circovirus (PCV) belongs to the family Circoviridae and the genus Circovirus. It is a non-enveloped single-stranded circular DNA virus and the smallest animal virus found so far. PCV has two serotypes, PCV-1 and PCV-2. PCV-1 is a conventional virus that can infect pigs and is not pathogenic to pigs. PCV2 was first reported in 1998 and is pathogenic to pigs. Clinically, it mainly causes post-weaning multisystemic wasting syndrome (PMWS), dermatitis-nephropathy syndrome (Porcine dermatitis and nephropathy syndrome, PDNS), Reproductive disorders, as well as respiratory and enteric diseases, cause significant economic losses to the swine industry worldwide. [0003] In 2016, a new circovirus serotype, PCV3, was reported in the United St...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701
Inventor 李晓菲秦立廷陈婷魏笑笑
Owner SHANDONG NEW HOPE LIUHE GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com