Primer and method for detecting mycoplasma, application of primer and product applying primer
A technology for mycoplasma and products, applied in the primers and application fields for detecting mycoplasma, can solve the problems of waste of time and scientific research cost of scientific researchers, insufficient sensitivity, poor broad-spectrum, etc., to save scientific research cost and time, expand the scope of application, reduce The effect of testing costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Extract the vero cells infected by the following mycoplasma respectively, and use the CTAB method to extract DNA:
[0063] Mycoplasma pirum、Mycoplasma arginini、Mycoplasma fermentans、Mycoplasmahominis、Mycoplasma hyorhinis、Mycoplasma orale、Mycoplasma pulmonis、Mycoplasmasalivarium、Mycoplasma timone、Mycoplasma faucium、Mycoplasma spumans、Mycoplasmaphocicerebrale、Mycoplasma auris、Mycoplasma alkalescens、Mycoplasmaarthritidis、Mycoplasma falconis、Mycoplasma gypis、Mycoplasma subdolum、 Mycoplasma anseris, Mycoplasma canadense, Mycoplasma zalophi, Mycoplasma cloacale, and Mycoplasma buccale.
[0064] Use primers PmyF and PmyR as amplification primers to set up a 20 μl reaction system:
[0065] The primer sequences are shown in the table below:
[0066] Primer
5'-3'
PmyF
SEQ ID NO.1
TACATAGGTCGCAAGCGTTATCC
PPML
SEQ ID NO.2
TCTAATCCTGTTTGCTCCCCAC
[0067] The reaction system is shown in the table below:
[0068] ...
Embodiment 2
[0071] Embodiment 2 Sensitivity
[0072] Using Mycoplasma hyorhinis genomic DNA as a template, dilute the DNA template according to the following concentrations: 1μg / mL, 100ng / mL, 10ng / mL, 1ng / mL, 100pg / mL, 10pg / mL, 1pg / mL, 100fg / mL, 10fg / mL mL, 1fg / mL.
[0073] The above-mentioned templates of each concentration were amplified with the primers and amplification methods provided in Example 1, and the results were as follows: figure 2 Shown: lane 1: 1μg / mL; lane 2: 100ng / mL; lane 3: 10ng / mL; lane 4: 1ng / mL; lane 5: 100pg / mL; lane 6: 10pg / mL; mL; lane 8: 100 fg / mL; lane 9: 10 fg / mL; lane 10: 1 fg / mL. Depend on figure 2 It can be seen that the primer can detect the DNA template with a concentration of 10fg / mL, and has high sensitivity.
Embodiment 3
[0075] Establish a 20 μL real-time fluorescent quantitative PCR reaction system, as shown in Table 1:
[0076] Reagent
volume
2×SYBR Premix Ex Taq
10 μL
PmyF (10μM)
0.4μL
PmyR (10μM)
0.4μL
template
2μL
DNA-free ddH 2 O (sterile water)
7.2 μL
[0077] Carry out real-time fluorescent quantitative PCR amplification reaction according to the following procedures:
[0078] Pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing and extension at 60°C for 30s, a total of 45 cycles; 95°C for 5s, 60°C-95°C, read the fluorescence value every 1min to generate the melting curve.
[0079] Establish a standard curve: use the Mycoplasma hyorhina genomic DNA template series concentration gradient 5ng / μl-0.5fg / μl as the template, take 2ul for each concentration gradient for detection, and use the Mycoplasma hyorhina genomic DNA template corresponding to 10ng-1fg. Standard curve R for standard concentra...
PUM
Property | Measurement | Unit |
---|---|---|
PCR efficiency | aaaaa | aaaaa |
PCR efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com