Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Escherichia coli recombinant bacterial strain for producing 3-dehydroshikimic acid as well as establishment method and application thereof

A technology of dehydroshikimic acid and recombinant strains, applied in the biological field, can solve problems affecting industrial applications, genetic instability, and production that cannot meet market demand, and achieve the effect of reducing production costs and medium costs

Active Publication Date: 2018-01-23
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the Escherichia coli engineering strain constructed in the above research can produce 3-dehydroshikimic acid, its output cannot meet the market demand, and its output needs to be improved
Moreover, the related engineering strains currently constructed either cause genetic instability due to the presence of recombinant plasmids, or need to add organic nitrogen sources or aromatic amino acids and their derivatives to the medium during the production process to promote cell growth, thereby affecting the industry. application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli recombinant bacterial strain for producing 3-dehydroshikimic acid as well as establishment method and application thereof
  • Escherichia coli recombinant bacterial strain for producing 3-dehydroshikimic acid as well as establishment method and application thereof
  • Escherichia coli recombinant bacterial strain for producing 3-dehydroshikimic acid as well as establishment method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0311] The construction of embodiment 1 escherichia coli recombinant strain WJ004

[0312] With the plasmid pEASY-cat-sacB (such as figure 2 (shown) is a template, and primer 41aroE1-up / aroE1-down is used to amplify the fragment aroE1 of homologous recombination in the first step. The sequence of primer 41 is:

[0313] aroE1-up (forward primer): GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATAGTGACGGAAGATCACTTC

[0314] aroE1-down (reverse primer): CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCAATCAAAGGGAAAACTGTCC

[0315] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5 mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TMFastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0316] The amplification conditions are: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extensio...

Embodiment 2

[0335] The construction of embodiment 2 escherichia coli recombinant strain WJ006

[0336] Using Escherichia coli DSM1576 genomic DNA as a template, the aroF gene was amplified using primer 61 aroF-F / aroF-R. The sequence of primer 61 is:

[0337] aroF-F (forward primer): ATGCAAAAAGACGCGCTGAA

[0338] aroF-R (reverse primer): TTAAGCCACGCGAGCCGTCAG

[0339] Amplification system: 5×TransStart TM Taq Buffer 5μL, dNTPs (2.5mmol / L each dNTP) 2μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 1μL, reverse primer (10μmol / L) 1μL, 100% DMSO 1μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL. Amplification conditions were pre-denaturation at 94°C for 5 minutes (1 cycle); denaturation at 95°C for 20 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0340] The amplified aroF gene fragment was cloned into the pEASY-Blunt vector (purchased from Be...

Embodiment 3

[0384] Example 3 Construction of Escherichia coli recombinant strain WJ012

[0385] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:7) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and primer 121tktA1-up / tktA1-down is used to amplify the fragment tktA1 of homologous recombination in the first step. The sequence of primer 121 is:

[0386] tktA1-up (forward primer): GCCCAAAACGCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCATGTGACGGAAGATCACTTC

[0387] tktA1-down (reverse primer): CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGACATATCAAAGGGAAAACTGTCC

[0388] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5 mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL. Amplification conditions were pre-denaturation at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an Escherichia coli recombinant bacterial strain WJ004 for producing 3-dehydroshikimic acid. The enzyme activity of 3-dehydroshikimic acid dehydrogenase is reduced by lowering the expression of the 3-dehydroshikimic acid dehydrogenase or by not expressing the 3-dehydroshikimic acid dehydrogenase. The bacterial strain can grow normally in a glucose inorganic salt culture medium and can produce 3-dehydroshikimic acid without adding aromatic amino acid and derivatives thereof and other growth factors, so that the cost of the culture medium is reduced, and the production cost of the 3-dehydroshikimic acid is reduced. The recombinant bacterial strain does not contain plasmid and is stable in heredity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the production of 3-dehydroshikimic acid recombinant Escherichia coli and its construction method and application. Background technique [0002] 3-dehydroshikimate (3-dehydroshikimate, DHS) is an important intermediate product in the biosynthetic pathway of aromatic amino acids in microorganisms and plants ( figure 1 ), which plays an important role in maintaining the normal development of organisms and completing metabolic processes (Draths KM, Kambourakis S, Li K, et al. Chemicals and mate-rials from renewable resources. Washington DC: American Chemical Society, 2001: 133-146.). DHS can be further catalyzed to form the precursors of the anti-influenza drug Tamiflu, shikimic acid, protocatechuate, vanillin, catechol, gallate and adipate ) and other important chemical products (Li K, Frost JW.Synthesis of vanillin from glucose.Journal of the American Chemical Society, 1998,120:10545...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/42C12R1/19
Inventor 王钦宏陈五九江小龙彭彦峰
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com