Expression and purification method of anti-cancer and anti-inflammatory polypeptide lunasin in mammalian cell cho-s
A mammalian and cell-based technology, applied in the field of protein engineering, can solve the problems of late development of mammalian cell expression system, high cost of cell culture, and difficult conditions to master, and achieve the effects of low cost, convenient and simple protein purification, and reduced release
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0038] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0039] 1) Search the Lunasin gene sequence in the NCBI database, and chemically synthesize the Lunasin gene in vitro. The sequence of Lunasin gene is shown in SEQ ID NO.1.
[0040] 2) Design primers for amplifying Lunasin gene. Forward primer (Lunasin-F) is CG TCCAAATGGCAGCACCAGC (SEQ ID NO.2), the restriction site is EcoRI (italics); the reverse primer (Lunasin-R) is CCG GTCGTCGTCATCATCATCATCGTC (SEQ ID NO. 3), the restriction site is XhoI (italics).
[0041] 3) PCR amplification of Lunasin gene. The amplification conditions were pre-denaturation at 95°C for 3 minutes, 30 cycles at 95°C for 30s, 55°C for 30s, and 72°C for 50s, and extension at 72°C for 10 minutes. The results of agarose gel electrophoresis showed that the PCR fragment conformed to the expected size of the target gene, see figure 1 .
[0042] PCR amplification system...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com