Supercharge Your Innovation With Domain-Expert AI Agents!

Application of alox12 inhibitor in the preparation of ischemia-reperfusion injury medicine

A technology for reperfusion injury and preparation of drugs, which is applied in the field of biomedicine and can solve the problems of injury and high mortality in patients with acute myocardial infarction

Active Publication Date: 2020-02-14
WUHAN HUIKANGDA TECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although heart bypass surgery, intervention and thrombolysis have made great progress, the mortality rate of patients with acute myocardial infarction is still relatively high. ischemia reperfusion injury

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of alox12 inhibitor in the preparation of ischemia-reperfusion injury medicine
  • Application of alox12 inhibitor in the preparation of ischemia-reperfusion injury medicine
  • Application of alox12 inhibitor in the preparation of ischemia-reperfusion injury medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0182] Example 1 Changes in the expression of different ALOX in ischemic liver tissue

[0183] C57 mice were randomly divided into two groups, namely the Sham group and the operation group. The liver tissues of the mice in the operation group and the mice in the Sham group were collected after ischemia for 1 hour, and the ALOX12, ALOX5, and ALOX15 proteins in the liver tissues were detected by Western blot and RT-RCR content and mRNA content. The primary antibodies used for WB are: 12-LO Antibody (C-5) (sc-365194; Santa Cruz), 15-LO Antibody (B-7) (sc-133085; Santa Cruz), 5-Lipoxygenase (C49G1) Rabbit mAb (#3289; CST), the secondary antibodies are: Peroxidase AffiniPure goat anti-rabbit-IgG(H+L)(#111-035-003; Jackson Laboratory) and goat anti-mouse-IgG(H+L)(#115 -035-003; JacksonLaboratory); The primer sequences used by RT-RCR are as follows:

[0184] Gene forward primer reverse primer ALOX12 TCCCTCAACCTAGTGCGTTTG GTTGCAGCTCCAGTTTCGC ALOX5 AACGA...

Embodiment 2

[0187] Example 2 Effect of ALOX12 Overexpression on H / R Treatment-Induced L02 Cell Injury and Inflammatory Response

[0188]L02 cells were divided into 4 groups: GFP overexpression control group, ALOX12 overexpression control group, GFP overexpression H / R group, ALOX12 overexpression H / R group. Corresponding plasmids were transfected into adherent L02 cells (about 80% confluency), and H / R treatment was performed after 24 hours (hypoxia for 6 hours and reoxygenation for 6 hours). After the plasmid transfection was completed, the total protein of the cells was extracted and analyzed by WB (three independent repeated experiments, each with 2 repetitions) to detect the overexpression of ALOX12. After the completion of H / R treatment, the release of LDH in the medium was detected (6 replicates per group) to evaluate the effect of ALOX12 overexpression on H / R-induced hepatocyte injury; RNA was extracted for RT-PCR analysis (2 times The experiments were repeated independently, each w...

Embodiment 3

[0194] Example 3 Effect of ALOX12 Knockdown (shALOX12) on H9C2 Cell Activity After H / R Treatment

[0195] H9C2 cells were divided into 4 groups: shRNA control group, shALOX12 control group, shRNA H / R group, and shALOX12H / R group. The corresponding recombinant lentivirus liquids were used to infect the cultured H9C2 cells, and H / R treatment was performed after 24 hours (hypoxia for 1 hour and reoxygenation for 6 hours). After the plasmid transfection was completed, the total protein of the cells was extracted and analyzed by WB (three independent repeated experiments) to detect the knockdown of ALOX12. Cell viability was detected after H / R was completed (6 replicates per group). Taking the detection result of the shRNA control group as 1, calculate the ratio of the other groups compared to this group.

[0196] ALOX12 knockdown WB detection results are as follows Figure 5 As shown, compared with the shRNA group, the shALOX12 histone band was significantly weakened, that is, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention finds through research that in liver ischemia-reperfusion injury, the changes of ALOX12 protein expression and mRNA expression are significant, while the changes of ALOX5 and ALOX15 have no difference, indicating that compared with other ALOX members, ALOX12 has a greater effect on liver ischemia-reperfusion injury. The effect of perfusion injury was greater. The overexpression of ALOX12 will aggravate the decreased activity of liver cells and kidney cells caused by hypoxia and reoxygenation, and promote the inflammatory response of liver cells; and the low expression of ALOX12 can alleviate the decreased activity of cardiomyocytes caused by hypoxia and reoxygenation, these The results show that ALOX12 can promote ischemia-reperfusion injury in organs such as liver, heart and kidney, as well as the development of other inflammatory responses in these organs. On this basis, ALOX12 can be used as a therapeutic target for ischemia-reperfusion injury and related diseases, as well as inflammatory diseases and cell death-related diseases.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to the use of ALOX12 inhibitors in the preparation of medicines, and the medicines are used to treat ischemia-reperfusion injury and related diseases, especially ischemia-reperfusion of organs such as liver, heart and kidneys injury, as well as the treatment of inflammatory diseases and cell death-related diseases in these organs. Background technique [0002] Lipoxygenase (arachidonate lipoxygenase, ALOX) is a class of enzymes that can catalyze arachidonic acid, linoleic acid, fatty acids and other polyunsaturated fatty acids to produce biologically active metabolites that participate in inflammatory and immune reactions. Mammalian ALOX is divided into four subtypes according to the specific position of oxygen molecules inserted into arachidonic acid: ALOX5, ALOX8, ALOX12, ALOX15, among which ALOX12 can be divided into 12S-LOX and 12R-LOX. [0003] At present, it is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/06A61P9/10A61P29/00A61P1/16A61P9/00A61P13/12C12N15/85C12N15/867A61K31/7105A61K31/635
CPCA61K31/7105A61K45/00A61K47/46A61P9/10
Inventor 李红良张晓晶
Owner WUHAN HUIKANGDA TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More