Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Mouse model with IRTKS gene in liver specifically eliminated as well as construction and applications of mouse model

A mouse model and specific technology, applied in genetic engineering, using vectors to introduce foreign genetic material, animal/human peptides, etc., can solve the problems of human diabetes deviation, there is no animal model of human diabetes, etc., to achieve weight gain, Effects on impaired glucose tolerance

Inactive Publication Date: 2017-05-31
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, since diabetes is a clinical syndrome caused by the interaction of multiple genetic backgrounds and environmental factors, although many animal models of diabetes have been developed, there are still deviations from human diabetes, and there is no one that is completely consistent with human diabetes. animal model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse model with IRTKS gene in liver specifically eliminated as well as construction and applications of mouse model
  • Mouse model with IRTKS gene in liver specifically eliminated as well as construction and applications of mouse model
  • Mouse model with IRTKS gene in liver specifically eliminated as well as construction and applications of mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, the construction of IRTKS-CKO mice

[0037] 1. Construction of IRTKS-CKO plasmid

[0038] see figure 1 100μg IRTKS-ABRLFn-pBR322 targeting vector DNA was linearized with NotI (enzyme dosage: 120U), the enzyme digestion system was 200μl, digested overnight at 37°C, treated with equal volume of phenol chloroform and chloroform, precipitated with absolute ethanol, 100μl sterile Resuspend in PBS for later use.

[0039] 2. ES cell targeting and screening

[0040] The linearized plasmid of the above-mentioned IRTKS-ABRLFn-pBR322 vector was used for ES cell targeting.

[0041] ES cells: SCR012

[0042] Amount of linearized IRTKS-CKO DNA: 35 μg

[0043] Electrotransfer instrument model: Bio-Rad Gene Pulser (Cat.No.165-2105)

[0044] Electroporation conditions: voltage 240v, capacitance 500μF, actual power-on time 9.6ms, actual voltage 256v

[0045] Cloning screening conditions: 300 μg / ml G418 and 2 μM GanC selection for 8 days

[0046] A total of 96 copies...

Embodiment 2

[0067] Example 2, Genotype identification of IRTKS-LKO mice and expression identification of IRTKS

[0068] 1. Mating and breeding F1 generation mice with Alb-Cre tool mice, using PCR to identify mouse genotypes, and obtaining IRTKS-LKO mice.

[0069] First design two pairs of PCR primers, see image 3 . Primer sequences are as follows

[0070] Neo (751bp) P5: TAGTTGCCAGCCATCTGTTG (SEQ ID NO: 5)

[0071] P6: CATCCTGCACTGCTCCTGTA (SEQ ID NO: 6)

[0072] WT (497bp) P7: CTGGGGTTCCTGAGACTTTG (SEQ ID NO: 7)

[0073] P8: CATCCTGCACTGCTCCTGTA (SEQ ID NO: 8)

[0074] And Cre universal primer: (293bp) P9: AACGCTGGTTAGCACCGCAGG (SEQ ID NO: 9)

[0075] P10: TATCTCGCGCGGCTCCGACA (SEQ ID NO: 10)

[0076] PCR reaction system (50 μl): 5U / ul TaKaRa rTaq 0.25 μl, 10X TaKaRa rTaq buffer 5 μl, 2.5 mM dNTP mixture 4 μl, DNA template 300 ng, forward and reverse primers 0.3-1 μM each, sterilized distilled water to make up the total volume to 50 μl.

[0077] PCR reaction conditions: 95°C f...

Embodiment 3

[0094] Example 3. Analysis of glucose metabolism in wild-type and liver-specific knockout IRTKS mice

[0095] 1. The body weight of 5.5-month-old male mice was found to be significantly higher in liver-specific knockout IRTKS mice than in wild-type mice Figure 7 .

[0096] 2. Use Roche Accu-Chek to detect the fasting blood glucose values ​​of IRTKS-LKO and WT mice, see the results Figure 8 . The blood glucose of IRTKS-LKO mice was significantly higher than that of WT.

[0097] 3. Male mice at the age of 5.5 months were fasted overnight and injected 1.5g / kg of glucose intraperitoneally with a 1ml syringe. Mouse blood glucose value, calculate the average value and standard deviation of mouse blood glucose at each time point, and carry out student's t-test statistical analysis, with the time point as the abscissa, the blood glucose value as the ordinate, and the standard deviation as the error value, draw Glucose Tolerance Curve, see results Figure 9 .

[0098] 4. Live...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mouse model with the IRTKS gene in the liver specifically eliminated as well as construction and applications of the mouse model. Through homologous recombination, a 2.245-kb frt-neo-frt-loxp-Flox-loxp sequence replaces a sequence containing exon2 in the mouse IRTKS gene, and thus the chimeric mouse with IRTKS<flox / +> is obtained; by utilizing the Cre recombinase, the obtained chimeric mouse mates with the mouse Alb-Cre with specific expression of Cre of the liver, and finally, the mouse model with IRTKS gene in the liver specifically eliminated is obtained. The mouse model with the IRTKS gene eliminated constructed by adopting the method provided the invention can be used for researching diabetes mellitus; through the body weight, fasting blood-glucose, sugar tolerance and clinicopathologic analysis, the result shows that the features conform to the human diabetes mellitus morbidity features, and thus a good animal model is provided for researching the diabetes mellitus morbidity mechanism and evaluating and screening treatment medicines.

Description

technical field [0001] The present invention relates to animal models in the field of biotechnology, more specifically, to a mouse model with IRTKS gene hepatic feature knockout, its construction method, and its application. Background technique [0002] Diabetes is a metabolic disease characterized by hyperglycemia caused by genetic factors, environmental factors and life behaviors. The morbidity rate, disability rate and mortality rate of diabetes, as well as the degree of harm to overall health, have ranked third among chronic non-communicable diseases, and the number of deaths caused by diabetes and its complications has also ranked first among the causes of death in the world. fifth place. Studies have reported that the number of people with diabetes in the world reached 382 million in 2013 and is expected to increase to 552 million by 2030. In the past 30 years, with the rapid development of my country's economy, the prevalence of diabetes in China has increased more...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/0362C07K14/47C12N15/8509C12N2800/107
Inventor 韩泽广黄丽钰吴崇超
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com