Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials

A primer-probe, quantitative detection technology, used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the deviation of quantitative results of PCR amplification efficiency, affect the dynamic PCR amplification process, improve Detection cost and other issues, to avoid cross-contamination and false positives, reliable results, accurate and sensitive results

Inactive Publication Date: 2017-03-22
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are the following problems in the quantitative detection of meat components by real-time fluorescent quantitative PCR technology: (1) Since each detection operation needs to carry out amplification of known concentration standards and make a standard curve at the same time, the detection cost is increased and the work (2) The single-copy coding sequence in the meat cell genome is severely degraded during food processing, resulting in low detection sensitivity; (3) The difference in PCR amplification efficiency may lead to deviations in quantitative results; (4 ) Impurities introduced into the DNA solution during DNA extraction or DNA degradation affect the dynamic amplification process of PCR, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials
  • Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials
  • Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] This embodiment tests the extraction quality of the total DNA of the sample by agarose gel electrophoresis.

[0028] The method used in this example is to prepare 2% agarose gel, take 2 μL of DNA sample and mix it with bromophenol blue, use DL2000 DNA Ladder Marker as a reference, and perform electrophoresis at a constant voltage of 100 V for 20 min. After the gel was stained with EB, it was imaged with a gel imaging system.

[0029] In this example, the total DNA of the samples mutton, chicken, duck, pigeon, goose, beef, horse, pork, donkey, rabbit, dog, rat, mouse, and fox was detected The quality of the extraction, and use sterile double distilled water as a blank control.

[0030] like figure 1 As shown, all samples can have bands above 2000 bp, indicating that all the samples to be tested have successfully extracted DNA.

Embodiment 2

[0032] The inventors of the present invention amplified the mutton replication protein A1 gene for the first time by real-time fluorescent PCR (probe method). The mutton replication protein A1 gene primer probe sequence used is Mutt-F5: CACCTCTTTCCA AGCATCCAGGTA (SEQ ID No. 1), GCTCACTCCTCCAGCCTAGCAAG (SEQ ID No. 2), FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1 (SEQ ID No. 3).

[0033] 1. Main testing instruments used:

[0034] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.

[0035] 2. Main reagents for detection:

[0036] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.

[0037] 3. Main steps of detection:

[0038] Real-time fluorescent PCR reaction system:

[0039] 2×Mastermix 12.5μL

[0040] Upstream primer (10mM) 1.0μL

[0041] Downstream primer (10mM) 1.0μL

[0042] Probe (10mM) 0.5μL

[0043] Template DNA 50ng

[0044] Add ste...

Embodiment 3

[0053] In this embodiment, the copy number of the mutton gene is quantitatively detected by digital PCR using the primer probe sequence of the mutton replication protein A1 gene. The mutton replication protein A1 gene primer probe sequence used is Mutt-F5: CACCTCTTTCCA AGCATCCAGGTA (SEQ ID No. 1), GCTCACTCCTCCAGCCTAGCAAG (SEQ ID No. 2), FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1 (SEQ ID No. 3).

[0054] 1. Main testing instruments used:

[0055] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12 000 r / min), etc.

[0056] 2. Main reagents for detection:

[0057] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.

[0058] 3. Main steps of detection:

[0059] Digital PCR reaction system:

[0060] 2×Mastermix 10 μL

[0061] Upstream primer (10mM) 1.0μL

[0062] Downstream primer (10mM) 1.0μL

[0063] Probe (10mM) 0.5μL

[0064] Template DNA 5.0 μL

[0065] Sterile double distilled water 2.5μL

[0066] Note: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to View More

Abstract

The invention relates to oligonucleotide primers and a probe used for precise and quantitative detection of ovine-derived materials, and a kit comprising the primers and the probe. The invention further relates to a digital PCR detection method used for quantitative detection of ovine-derived materials. The method involves use of the specific oligonucleotide primers and the fluorescent mark probe specific to the mutton single-copy nuclear gene. The invention further relates to the application of the specific oligonucleotide primers and the fluorescent probe specific to the mutton single-copy nuclear gene in quantitative detection of ovine-derived materials. By means of the digital PCR detection method, the content of ovine-derived materials in a sample can be determined precisely and sensitively.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to oligonucleotide primers and fluorescently labeled probes for the detection of sheep-derived components, and a kit containing the primers and probes for the determination of sheep-derived components The digital PCR detection method and the application of the specific oligonucleotide primers and probes of sheep-derived components in the sample in the detection of sheep-derived components. Background technique [0002] Meat products account for a large proportion of residents' food consumption, but in recent years, the adulteration and sale of meat in my country has been rampant, and the masses hate it. In 2004, the public security and industrial and commercial departments uncovered a number of cases of "adulterated mutton" produced from fox, mink and duck meat, which aroused widespread public concern. A reporter from the Beijing News found that the mutton wholes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q1/6851C12Q2531/113C12Q2563/107
Inventor 陈颖黄文胜邓婷婷葛毅强任君安
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com