Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine
A technology of porcine circovirus and plantarum lactobacillus, which is applied in the field of preparation of porcine circovirus type 2 recombinant lactobacillus plantarum oral vaccine, can solve the problems of long time, high price, inability to use emergency vaccination, etc., and achieve high expression level , to express a stable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Cloning of circovirus
[0039] DNA virus extraction kit was used to extract the genome from the disease materials collected from pig farms, and two pairs of primers were designed. By PCR, positive samples were detected from the collected disease materials with primers P1 and P2, and then P3, P4 amplifies the sequence of the whole virus of PCV2:
[0040] Primer P1: AATGGCATCTTCAACACCC
[0041] Primer P2: TTAAGGGTTAAGTGGGGGGTC
[0042] Primer P3: CCCAAGCTTCCGCGGGCTGGCTGATTTGAAAGT
[0043] Primer P4: GGGGTACCCCGCGGAAATTTCTGACAAACGTTAC
[0044] The specific process is as follows:
[0045] S1. Using the genome extracted from the disease material as a template, use primers P1 and P2 to detect virus specificity. The PCR program is: pre-denaturation, 94°C for 5 minutes; denaturation, 94°C for 45s; annealing, 55°C for 30s; extension , 72°C for 30s; after 30 cycles, the final extension was 10min at 72°C. After electrophoresis, the sample that could amplify a band o...
Embodiment 2
[0048] Example 2 Construction of Lactobacillus plantarum expression vector
[0049] Design a pair of primers (P6 and P5) to amplify the sequence of ORF2 reading frame (Cap protein)
[0050] P5: CCCTCGAGATGATGACGTATCCAAGGAGGCGTTTC
[0051] P6: CCGAGCTCTTACTTAGGGTTAAGTGGGGGGTCTTTAAG
[0052] Construction of recombinant Lactobacillus expression vector: (1) Using the plasmid pMD19-PCV2 as a template and P5 and P6 as primers, the sequence of the Cap protein of PCV2 was amplified with high-fidelity enzymes. The PCR program was: pre-denaturation, 94°C for 5 minutes ; Denaturation, 94°C 45s; Annealing, 54°C 30s; Extension, 72°C 2min; After 30 cycles, 72°C final extension 10min after electrophoresis identification, a band of about 700bp was amplified.
[0053] (2) After the band of about 700bp is purified and recovered, it is connected to the pPSCPSP vector: the product after PCR amplification is recovered by 1% agarose gel electrophoresis and used together with the expression vector...
Embodiment 3
[0055] Example 3 Expression and identification of protein
[0056] 1. The expression of the target gene in Lactobacillus plantarum and the SDS-PAGE identification of the expression product: the transformed positive recombinant bacteria pPSCPSP-Cap-LP-1 and the empty vector pPSCPSP-LP-1 were cultured in MRS liquid medium Overnight, inoculate the bacterial solution after overnight cultivation into an appropriate amount of MRS solution at a ratio of 2%, culture at 37°C for about 28 hours, take the supernatant, precipitate with 80% ammonium sulfate, refold the protein with PBS, concentrate and treat it with 12 % of the separated protein gel electrophoresis, and the corresponding protein bands were detected by SDS-PAGE protein electrophoresis ( image 3 ), image 3 The results showed that the empty plasmid group had no target band, and the recombinant Lactobacillus plantarum group had a target band of about 28 kDa.
[0057] 2. The expression of the target gene in Lactobacillus pl...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com