Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene

A mutation site, TERT-R technology, applied in the field of life sciences and biology, can solve the problems of low abundance and singleness of non-specific amplification products, achieve low cost, simple operation, and improve the effect of amplification specificity

Inactive Publication Date: 2016-06-22
南京艾迪康医学检验所有限公司
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Touch-down PCR amplification can ensure that the combination of the forward and reverse amplification primers and the sample DNA template occurs between the most complementary sequences. When the annealing temperature is reduced to the level where non-specific amplification occurs, specific amplification products At this time, there is already a geometric number of initial advantages, and the abundance is high. In the remaining amplification reactions, the specific amplification products compete with the non-specific amplification products, but because the abundance of non-specific amplification products is relatively high Low, specific amplification products are always preferentially amplified, resulting in a single dominant specific amplification product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene
  • Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Primers for detecting TERT gene promoter C228T, C250T mutation sites, including: forward and reverse primers for amplifying TERT gene promoter C228T, C250T mutation sites; its base sequence is:

[0042] TERT-F: AAGGAAGGGGAGGGGCTGGG

[0043] TERT-R: CGACCTCTCTCCGCTGGGGC.

[0044] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is

[0045] TERT-S-F: AAGGAAGGGGAGGGGCTGGG

[0046] TERT-S-R: CGACCTCTCTCCGCTGGGGC.

[0047]In the detection, first use the above-mentioned forward and reverse primers to amplify the C228T and C250T mutation sites of the TERT gene promoter to obtain the amplified products, and then use the above-mentioned pair of sequencing primers to sequence the amplified products to obtain the amplified products base sequence.

[0048] The kit for detecting the C228T and C250T mutation sites of the TERT gene promoter, including: sample DNA extraction reagents (for example, use Tiangen Biotech’s kit to extract sam...

Embodiment 2

[0062] Detection process:

[0063] (1) Use the blood DNA extraction kit (Tiangen Biology) to extract the genomic DNA in the blood sample:

[0064] 1) Take 500 μl of blood and add 1000 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.

[0065] 2) Add 20 μl proteinase K solution and mix well.

[0066] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0067] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0068] 5) Put the solution and flocc...

Embodiment 3

[0095] The nucleic acid detection kit of the present invention is used to detect clinical samples.

[0096] 20 samples of anticoagulated blood samples from patients with glioma were taken for inspection, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.

[0097] Add 2 μl of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. Detect with common PCR instrument, the time is 160 minutes.

[0098] Electrophoresis results such as figure 1 As shown, it shows that the forward and reverse primers TERT-F and TERT-R used in the present invention can effectively amplify the blood sample, and the band is single.

[0099] The results of forward sequencing of the TERT gene promoter C228T of sample 1 are as follows: figure 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, a primer and a kit for detecting mutation sites of promoters C228T and C250T of a telomerase reverse transcriptase (TERT) gene. The primer comprises a forward primer and a reverse primer for amplifying the mutation sites of the promoters C228T and C250T of the TERT gene, and in addition, can also comprise one pair of sequencing primers. A Touch-down PCR (Polymerase Chain Reaction) amplification technique is combined with a Sanger sequencing method; the occurrence conditions of the mutation sites of the promoters C228T and C250T of the TERT gene in a body of a patient suffered from a brain glioma can be quickly detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to primers, methods and kits for detecting C250T and C228T mutation sites of TERT gene promoters. Background technique [0002] Glioma is the most common primary malignant tumor in the nervous system. The clinical and basic researches that have been carried out have proved that the prognosis of glioma is extremely poor. The biological characteristics of malignant tumors such as uncontrollable tumor cell proliferation, slowed tumor cell apoptosis, tumor cell invasiveness, and new blood vessel growth make the brain The treatment of glioma faces enormous difficulties. Human telomerase is one of the tumor markers, and the activation of telomerase plays an important role in the occurrence and development of tumors. Telomerase is composed of telomerase RNA, telomerase-associated protein, and telomerase reverse transcriptase (TERT). TERT is considered to be a key...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6886C12Q2600/156C12Q2531/113C12Q2535/101
Inventor 单战刘赵玲王淑一
Owner 南京艾迪康医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com