Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method

A technology of hydroxymethylcytosine and methylcytosine, which is applied in the direction of DNA preparation, recombinant DNA technology, biochemical equipment and methods, and can solve problems such as PCR reaction failure, sequencing error, and efficiency decline

Active Publication Date: 2018-06-29
北京玄鸟飞讯科技有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] According to the above analysis, there are three reasons why the existing enrichment methods have not achieved major breakthroughs: First, the DNA after enrichment is too small, and the loss is too large during the construction of the sequencing library
The traditional process of building a library involves multi-step reaction purification, and the purification efficiency of a small amount of DNA is low. Second, the efficiency of the enrichment method on low-concentration DNA decreases. When using antibody enrichment, the binding efficiency is directly related to the antigen concentration. The reported antigen-antibody binding ability cannot meet the reaction at extremely low DNA concentration; the third is that the enriched DNA cannot be effectively eluted from the solid phase, and the solid phase-loaded DNA only accounts for the original concentration during the enrichment process. Within 5% of DNA
The purification or chemical reaction involved in the elution process will greatly lose the DNA fragments loaded on the solid phase, resulting in failure of subsequent PCR reactions or introducing a large number of sequencing errors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method
  • DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method
  • DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Establishment of 5-methylcytosine sequencing library of serum free DNA

[0053] (1) DNA purification and fragmentation pretreatment:

[0054] 4mL of human blood was collected in EDTA anticoagulant tubes and stored at 4°C. Within 6 hours, centrifuge for 10min at a centrifugal speed of 2000g; centrifuge again for 10min at a centrifugal speed of 13000g. Plasma was obtained and cell-free DNA was extracted.

[0055] (2) The repair of trace DNA is connected with the adapter primer, and the sequence of the adapter primer is as follows:

[0056] 5'-p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAACATCGATCTCGTATGCCGTCTTCTGCTTG-3';

[0057] 5'-AATGATACGGCGACCACCGAGATCTACACATGCCTAAACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3', * indicates thioxo.

[0058] 0.5-10ng of free DNA was repaired and ligated with sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blu...

Embodiment 2

[0093] Example 2 Establishment of hydroxymethylcytosine sequencing library of serum cell-free DNA

[0094] (1) DNA purification and fragmentation pretreatment:

[0095] 4mL of human blood was collected in EDTA anticoagulant tubes and stored at 4°C. Within 6 hours, centrifuge for 10min at a centrifugal speed of 2000g; centrifuge again for 10min at a centrifugal speed of 13000g. Plasma was obtained and cell-free DNA was extracted.

[0096] (2) Repair of trace DNA and connection of adapter primers:

[0097] 0.5-10ng of free DNA was repaired and ligated with sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blunt ends. Proceed as follows:

[0098] 1. According to the instructions of Kapa Hyper Perp Kit, put 50uL DNA in the PCR tube for End Repair&

[0099] A-Tailing response,

[0100]

[0101]

[0102] 2. Heat the reaction following the PCR pr...

example 3

[0129] The 5-methylcytosine sequencing library of example 3 tissue DNA is established

[0130] (1) DNA purification and fragmentation pretreatment:

[0131] Tissue genomic DNA was extracted with ZR Genomic DNA-Tissue Kits (Zymo). According to the following KapaHyperPlus Library Preparation Kit, react 0.5-100ng of genomic DNA to fragment genomic DNA.

[0132]

[0133] (2) Repair of trace DNA and connection of adapter primers:

[0134] The fragmented DNA is repaired and ligated with the sequencing adapter primers required for next-generation sequencing. DNA fragment repair refers to the repair of base damage in DNA fragments and filling the 5' and 3' of DNA into blunt ends. Proceed as follows:

[0135] 1. According to the instructions of Kapa HyperPLus Library Preparation Kit, put 50uL DNA in the PCR tube for End Repair&A-Tailing reaction,

[0136]

[0137] 2. Heat the reaction following the PCR program

[0138]

[0139] 3. Prepare the following ligation reaction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

Provided is a sequencing method for the genetic mapping of DNA 5-methylcytosine and 5-hydroxymethylcytosine. The method employs next generation sequencing and library construction technology for trace free DNA and a high-efficiency chemical bioorthogonal reaction, which greatly enhances the selectivity and efficiency of a solid-phase surface binding to a DNA modified base.

Description

technical field [0001] The invention relates to a DNA 5-methylcytosine and 5-hydroxymethylcytosine gene map sequencing method, which belongs to the field of gene sequencing. Background technique [0002] DNA is not only composed of four bases, cytosine, thymine, guanine, and adenine. 5-Methylcytosine and 5-Hydroxymethylcytosine are important modifications in DNA. Modified bases are the fifth and sixth bases on DNA. They are important markers in the regulation of biological pathways, the cell life cycle, and serve multiple biological functions, including transcriptional regulation, transposon silencing, gene imprinting, and X chromosome inactivation. In many diseases, especially major diseases such as cancer, there are specific genome distributions, and there are obvious distribution changes in the early stages of fertilization and development, which are considered to be involved in and mark these processes. Therefore, it is particularly important to use sequencing technolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C40B50/06
CPCC12N15/10C12Q1/68C40B50/06
Inventor 陆星宇宋艳群
Owner 北京玄鸟飞讯科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com