Saussurea involucrata cell squalene synthase (SiSQS) gene as well as products coded by same and application thereof
A technology of squalene synthase and cell shark, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Saussurea oleifera cell transcriptome sequencing
[0032] Trizol was used to extract the total RNA of Saussurea tianshanensis cells, and sequenced by the IlluminaHiseq2000 platform, a total of 14372403000nt data was produced. As a result, there are 148718 Unigenes in total, the total length is 138529450nt, the average length is 931nt, and the N50 reaches 1515nt. Unigene functional annotations, the Unigenes annotated to NR, NT, Swiss-Prot, KEGG, COG, and GO libraries are 77514, 63458, 49750, 45573, 28939, 55950, and the Unigenes on all annotations are 83169 . Prediction of coding protein frame (CDS), there are 75735 CDS compared to the protein library, 5305 predicted CDS, a total of 81040. Through the analysis of GO annotation, Blast comparative analysis and MEGA6.0 phylogenetic tree construction, the sequence of the squalene synthase gene family in Saussurea chinensis cells was obtained.
[0033] Said Saussurea tianshanensis cells are obtained according to ...
Embodiment 2
[0034] Cloning of the squalene synthase gene in Saussurea sauraceae cells of embodiment 2
[0035] For the cloning of SiSQS, the forward primer: P1: 5'ATGGGGAGTTTAAAAGCAGTGTTGA3', the reverse primer P2: 5'TTACAACGTAAGCTTGATTTTATTT3', and the full-length sequence of the squalene synthase SiSQS coding gene of Saussurea sauraceae cells were used as templates for PCR amplification. The amplification system is as follows: 10×Buffer2.5μL, dNTP (2.5mmol·L -1 ) 1 μL, 1 μL each of primers P1 and P2, TaqDNA polymerase (5U·L -1 ) 0.2 μL, 1 μL (about 20 ng) of the template, and make up the rest with sterile double distilled water. Reaction conditions: pre-denaturation at 94°C for 5min, 94°C for 30s, annealing at 56°C for 30s, extension at 72°C for 2min and 30s, extension at 72°C for 10min after 35 cycles, and storage at 4°C. So far, the clone of squalene synthase SiSQS gene of Saussurea chinensis has been obtained.
Embodiment 3
[0036] The bioinformatics analysis of embodiment 3SiSQS gene
[0037]The full-length cDNA of the Tianshan Snow Lotus squalene synthase gene SiSQS provided by the present invention is 1846 bp in length, and the detailed sequence is shown in SEQ ID NO.1 in the sequence listing, wherein the open reading frame is located at 222-1478 bp. The SiSQS gene sequence was searched for nucleotide homology in the Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundantGenBankCDStranslation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. The gene has homology with SQS in other species at the amino acid level, and has a typical Isoprenoid_Biosyn_C1superfamily domain. like figure 1 and figure 2 . in figure 1 Predictive analysis for SiSQS structural functional domain (from NCBI database); figure 2 SiSQS phylogenetic tree (neighbor-joining method).
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com