Construction method and use of a Jian carp retrotransposon and transgene vector
A technology of retrotransposon and gene carrier, which is applied in the field of genetic engineering to achieve the effect of good homology and high transposition efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1. Acquisition and analysis of Jianli ty3-gypsy retrotransposon JRE
[0025] 1.1 Experimental fish
[0026] Jian carp were preserved in our laboratory, and blood was collected for genomic DNA extraction.
[0027] 1.2 Genomic DNA extraction
[0028] Jian carp genomic DNA was extracted using the Whole Blood Genomic DNA Extraction Kit of Dalian Bao Bioengineering Co., Ltd., and the main steps were as follows: 5 Jian carps were taken, and blood was collected from the tail vein aseptically. After digestion at ℃ for 15 min, 200 µL of 100% ethanol was added for column purification, and finally the DNA bound to the membrane was eluted with elution buffer, and checked by agarose gel electrophoresis. DNA samples were diluted with distilled water for later use, and other samples were stored at –70°C for later use.
[0029] 1.3 PCR amplification and detection
[0030]According to the partial sequencing results of the Jian carp genome in the previous study and the releva...
Embodiment 2
[0037] Example 2 Construction of Retrotransposon Transposition Vector
[0038] 1 Experimental method
[0039] Primer design, synthesis, and gene sequencing: According to the principle of In-Fusion technology, when designing cloning primers, 15 bases at both ends of the linearized p-GCFU were introduced on the outside of the upstream and downstream primers targeting the Survivin gene sequence, so that the cloning The 15 bases outside the primers are homologous to the 15 bases at both ends of the linearized vector, and the downstream primers remove the three bases of the stop codon. Synthesize a pair of primers 5'ACCGGACATATGCCCGGGGATACATCGCCCATCCCTACG3', 5'CCTGCAGGAATTCCCGGGGATACATCGCCCATCCC T ACG3'. The primers for PCR identification were designed according to Survivin and the vector, in which the upstream primer was located in Survivin, the downstream primer was located in the vector, and the downstream primer was also used for subsequent sequencing identification of positiv...
Embodiment 3
[0049] Example 3 Application of Retrotransposon Transposition Vector
[0050] 1 Experimental method
[0051] Select green fluorescent protein (GFP) as the reporter gene, design a pair of primers, both ends of the primers contain AflII and NaeI restriction sites, use PCR to amplify the GFP reporter gene, the pcr reaction program is: 94 ℃ 30s, 60 ℃ 5min, 72 ℃ 45s, a total of 30 cycles, the PCR product was detected by 1% agarose gel electrophoresis, the target fragment was recovered, connected to the pMT18T vector (Takara), and verified by sequencing (Zhongmei Taihe Company). The PCR product and expression vector obtained by sequencing were digested and recovered by 1% agarose gel electrophoresis. Then use T4 DNase to ligate and connect to the JRE transposon carrier, and the ligation product is still cloned and amplified by IN-FUSION technology. The screened positive plasmids were sent to Shanghai Boshang Company for sequencing, and the sequencing results showed that the GFP ge...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com