A detection kit and detection method utilizing antibody modified immune PCR reaction
A technology of antibody modification and kit, which is applied in the field of immunological detection, can solve the problems of decreased antibody specificity and affinity, difficult to break through 1000 times of sensitivity, and varying degrees of improvement, and achieve broad detection sensitivity, wide dynamic range, and simplified detection The effect of the process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1: Biotin Modification of Insulin Antibody 3A6
[0069] The Insulin monoclonal antibody 3A6 (ab1965) from Abcam needs to be biotin-modified before it can be specifically coated on a streptavidin PCR 96well microwell plate (Pierce, Cat No.15500) for Immuno- PCR detection. The antibody was modified using the SiteClick series labeling kit (S10467) and DIBO-labeled biotin (C10412) from Life Technologies.
[0070] (1) Purification and modification of antibodies are carried out first.
[0071] The first round of purification: first add 0.5mg / ml 250μL 3A6 antibody solution to the antibody concentrator (an ultrafiltration centrifuge tube with unknown molecular weight cut-off) attached to the kit, which can concentrate the antibody and replace the buffer Add 500 μL of antibody replacement buffer (buffer A) to the concentrator and centrifuge at 4° C. for 5 minutes at 6000 × g. After the centrifugation is completed, use a pipette to absorb the remaining solution to clean...
Embodiment 2
[0076] Example 2: ssDNA modification of Insulin antibody
[0077] (1) Synthesis of ssDNA with DIBO marker (dibenzocyclooctyne):
[0078] a. Generate a random sequence with a length of 100bp through the DNA sequence random synthesis website (http: / / www.facμLty.ucr.edu / ~mmaduro / random.htm)
[0079] 5'-ATGGGGCTGGATAAAACTGCCCTGGTGACCGCCATCAACAACCCGAATACGTGGCATTTCAGGAGGCGGCCGGAGGGGGATGTTTTCTACTATTCGAGG-3' (SEQ ID No. 1).
[0080] Through the blastn search program (http: / / www.ncbi.nlm.nih.gov / BLAST / Blast.cgi), it was confirmed that the sequence does not have any known sequences homologous to it, so as to ensure that the subsequent PCR detection signal is specific information from antibody binding .
[0081] After determining the sequence of the ssDNA, the 5' terminal DIBO-marked ssDNA (SEQ ID No.1) and two PCR primers for amplifying the fragment were synthesized by IDT (www.idtdna.com):
[0082] 5'-ATGGGGCTGGATAAAACTGC-3' (SEQ ID No.2) and
[0083] 5'-CCTCGAATAGTAGAAAACATCCCC-3'...
Embodiment 3
[0091] Embodiment 3: the making of Insulin immune PCR standard curve
[0092] (1), Preparation of Immuno-PCR microwell plate:
[0093] The DIBO-labeled biotin-modified Insulin antibody 3A6 solution obtained in Example 1 was coated on a streptavidin PCR microwell plate (Pierce Company, Cat No. 15500): after overnight incubation for 12 hours at 4°C , the antibody-coated microplate was washed three times with PBST buffer (1×PBS, 0.1% Tween 20), and then washed with PBST-BSA buffer (1×PBS, 0.1% Tween 20, 5% BSA) at 4°C Incubate the microwell plate overnight, and then wash the microwell plate with PBST buffer three times for use to obtain an Immuno-PCR microwell plate.
[0094] (2), InsuLin Immuno-PCR standard curve formulation:
[0095] a, first prepare human source Insulin standard substance (mother solution, 10mg / mL, Sigma company), the concentration of standard substance is from 33ng / ml to 3.3x10E-5ng / ml 10-fold equal dilution, has 7 different concentrations altogether; Gradi...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com