Neuropeptide snpf and its receptor gene and its application in Bactrocera dorsalis specific control agent
The technology of fruit fly and neuropeptide, which is applied in the field of genetic engineering, can solve the problems of aggravating the outbreak of agricultural pests, low specificity of pesticides, and threatening natural enemies of pests, etc., and achieves the effect of good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Obtaining the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor
[0041] 1. Primer design and amplification of the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor
[0042] Based on genome and transcriptome data, using bioinformatics methods, after repeated analysis and comparison of Drosophila sNPF (Genbank No.AY626808) and its sNPFR (Genbank No.NP524176), the neuropeptide sNPF and its receptor of Bacteralis dorsalis were designed (sNPFR) nested PCR specific primers, the sequence is as follows:
[0043]
[0044] The total RNA of B. dorsalis was extracted with an RNA extraction kit, and reverse transcribed into cDNA with a reverse transcription kit.
[0045] Amplify Bacteralis dorsalis neuropeptide sNPF sequence: 50ul reaction system contains 24μL deionized water, 20μL 2×PrimeSTAR Max Premix, primers sNPF-1-F (as shown in SEQ ID NO: 1 in the sequence listing), sNPF- 1-R (shown as SE...
Embodiment 2
[0058] Example 2. Determination of the binding ability of Bacteralis dorsalis neuropeptide sNPF to its receptor based on intracellular calcium ion flow detection method
[0059] 1. Construction of Bacteralis dorsalis sNPFR CHO (Chinese hamster ovary cell) cell expression plasmid
[0060] The Bacteralis dorsalis neuropeptide sNPFR plasmid and pcDNA3.1 (+) plasmid connected on the T carrier recovered in Example 1 were connected (T4 DNA ligase) after NotI single enzyme digestion respectively, and after connection, refer to The transformation method in Example 1 was transformed, and after the positive identification of the bacterial liquid was correct (PCR detection was performed with the universal primer T7 / BGH, T7: TAATACGACTCACTATAGGG, BGH: TAGAAGGCACAGTCGAGG), the plasmid was extracted with a plasmid extraction kit, and the sNPFGPCR was obtained. Fragment of the pcDNA3.1(+) plasmid.
[0061] Co-transfection:
[0062] 1) Prepare 1.5mL serum-free medium DMEM / F-12medium in EP t...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com