Plant expression vector of tobacco gibberellin synthetic transcription regulator gene and its application
A technology of transcriptional regulator and plant expression vector, applied in the field of plant genetic engineering, can solve the problems of lack of function, dwarfing plant phenotype, affecting the synthesis of GAs, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1: PCR amplification and TA cloning of RSG gene cDNA
[0042] Find the cDNA sequence of the tobacco RSG gene from GenBank, and design a pair of primers with the following sequence:
[0043] Upstream primer 5' GGATCCATGGACCCGAAGTTCAGCGGAAAGC 3' (contains BamHI site)
[0044] Downstream primer 5' CTCGAGTCAACCCCTGTTATTGAAGTTCATG 3' (contains XhoI I site);
[0045] Add a characteristic sequence to the 5' end of the upstream primer, and thus form a BamHI restriction site; add an XhoI I restriction site to the 3' end of the downstream primer, and use the first-strand cDNA of tobacco as a template to amplify to obtain the full-length cDNA of the RSG gene .
[0046] Take 0.2g of treated tobacco leaves (Fresh weight, FW) and freeze them rapidly in liquid nitrogen, use the TRI-ZOL method to roughly extract total RNA according to the instructions of Invitrogen’s TRI-ZOL Reagent, and treat the water with 25 μl DEPC (1 / 1000 ) Dissolve RNA, take 1 μl for electrophoresis...
Embodiment 2
[0049] Example 2: NtRSG entry cloning vector pENTR-2B-NtRSG and plant overexpression vector pK2-35S- RSG build
[0050] TA cloned and sequenced successfully pMD18-T- in Example 1 RSG Carry out BamHI and XhoI double-enzyme digestion with pENTR-2B, which was tested correctly before in the laboratory, and then cut the gel to recover, and subclone the recovered fragment of RSG gene into pENTR by ligase to obtain the entry cloning vector pENTR- RSG , the construction of plant expression vector through Gateway LR reaction technology to construct plant overexpression vector pK2-35S- RSG , The LR reaction plasmid needs to be purified by a plasmid purification kit, and the recombinant vector after successful transformation needs to be screened by Spe (spectinomycin)-resistant LB medium. Build strategies such as figure 2 As shown, the plant expression vector will be recombined and integrated into the tobacco genome through T-DNA insertion, and express the RSG gene. This structure w...
Embodiment 3
[0051] Embodiment 3: the cultivation and screening of Agrobacterium impregnated tobacco and transgenic tobacco
[0052] Using the leaf disc transformation method, using Agrobacterium tumefaciens C58C1 as the medium, transfect tobacco for 15-20 min, and the tobacco explants after successful dipping were placed in MS1 medium (containing 3% sucrose) and co-cultured in the dark for 48 h , and then transferred to MS4 germination medium (containing 3% sucrose, 50 μg / ml kalimycin and 100 μg / ml cephalosporin) to differentiate calli and induce germination. , 12 h light, 200 lx) about 25 days later, the successfully transfected explants will differentiate into transgenic seedlings. Mycin) agarose medium for subculture once to inhibit the growth of Agrobacterium, and subsequent subcultures can be cultured in non-resistant rooting medium MS agarose medium.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com