A broadspectrum efficient antimicrobial peptide Pb-CATH-OH1, a gene thereof, a preparing method of the peptide and applications of the peptide
An antimicrobial peptide, pb-cath-oh1 technology, applied in the field of biomedicine to achieve the effects of good killing effect, simple structure and strong antibacterial activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] Specific embodiments of the present invention will be described in detail below in conjunction with technical solutions, but the content of the present invention is not limited thereto.
[0021] Strictly follow the kit instructions, using RNeasy AxyPrep TM Multisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) was used to extract the total RNA from Burmese python lung tissue, and then use Creator TM SMART TMThe cDNA Library Construction Kit was used to construct the cDNA library of Burmese python lung tissue. Use the PowerScript Reverse Transcriptase in the kit to reverse transcribe and synthesize the first strand of cDNA. The primers are:
[0022] Forward SMARTⅣOligonucleotide primer:
[0023] 5'–AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG–3'
[0024] Reverse CDSⅢ / 3'PCR primer: 5'–ATTCTAGAGGCCGAGGCGGCCGACATG-d(T) 30 N -1 N–3’ (N=A, C, G, or T; N -1 = A, G, or C).
[0025] Use Advantage DNA Polymerase to synthesize the second strand of cDNA. The primer ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com