Primer, kit and detection method for detecting 245bp deletion alternative spliceosome of LEPR gene
A splicing body and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., can solve problems such as low accuracy, cumbersome procedures, and long time consumption, and achieve strong applicability Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] The specific implementation of the present invention will be described in detail below in conjunction with the accompanying drawings and examples.
[0024] Depend on figure 1 As shown, the present invention is realized by the following technical solutions in specific implementation.
[0025] one for testing LEPR Primers for gene 245bp deletion alternative splice body, including primer pair P and primer pair ACTB,
[0026] The primer pair P is:
[0027] Upstream primer, P-F: 5'-TCCCTACCAAGATGCTGAC -3';
[0028] Downstream primer, P-R: 5'-TTGCTCGCGATCGTTCACA-3';
[0029] Described primer pair ACTB is:
[0030] Upstream primer, ACTB-F: 5'- GAGAGAAGATGACACAGAC -3';
[0031] Downstream primer, ACTB-R: 5'- GTCCATCACAATACCAGTGG -3'.
[0032] The primer is effectively used for preparing a kit for detecting the 245bp deletion alternative splicing body of the LEPR gene.
[0033] one for testing LEPR A test kit for gene 245bp deletion alternative splice body, said te...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com