Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and kit for detecting 127bp deletion variable spliceosome of LEPR gene and detecting method

A splicing body and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., can solve problems such as low accuracy, cumbersome procedures, and long time consumption, and achieve strong applicability Effect

Active Publication Date: 2015-06-03
HENAN AGRICULTURAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the above situation, in order to overcome the defects of the prior art, the purpose of the present invention is to provide a method for detecting alternative splicing of LEPR gene 127bp deletion The primers for the body and the kits and detection methods containing the primers can effectively solve the problems of cumbersome procedures, long time-consuming and low accuracy of the existing detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and kit for detecting 127bp deletion variable spliceosome of LEPR gene and detecting method
  • Primer and kit for detecting 127bp deletion variable spliceosome of LEPR gene and detecting method
  • Primer and kit for detecting 127bp deletion variable spliceosome of LEPR gene and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The specific implementation of the present invention will be described in detail below in conjunction with the accompanying drawings and examples.

[0024] Depend on figure 1 As shown, the present invention is realized by the following technical solutions in specific implementation.

[0025] A primer for detecting LEPR gene 127bp deletion alternative splicing body, including primer pair P and primer pair ACTB,

[0026] The primer pair P is:

[0027] Upstream primer, P-F: 5'- CTTGTGAACGATCGCATGTG -3';

[0028] Downstream primer, P-R: 5'- GTGGTATCTTAACTGCAAGG -3';

[0029] Described primer pair ACTB is:

[0030] Upstream primer, ACTB-F: 5'- GAGAGAAGATGACACAGAC -3';

[0031] Downstream primer, ACTB-R: 5'- GTCCATCACAATACCAGTGG -3'.

[0032] The primer is effectively used for preparing a kit for detecting the 127bp deletion alternative splicing body of the LEPR gene.

[0033] one for testing LEPR A test kit for gene 127bp deletion alternative...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting 127bp deletion variable spliceosome of LEPR gene and a kit containing the same and a detecting method. The problems of tedious procedure, long time consumption and low accuracy can be effectively solved. The detecting method comprises the following steps: by taking a cDNA to be tested as a template and taking a primer pair ACTB as a primer, carrying out real-time fluorescence quantification PCR amplification on an ACTB reference gene; and by taking a primer pair P as a primer, carrying out real-time fluorescence quantification PCR amplification on 127bp deletion alternative spliceosome of LEPR gene, wherein the reaction system of the fluorescence quantitative PCR amplification includes ultrapure water for removing the RNA enzyme, a primer P-F or ACTB-F, a primer P-R or ACTB-R and a cDNA template, and the reaction method comprises the steps of pre-denaturing, denaturing, annealing, extending and circulating for 35-45 times, analyzing the qPCR real-time monitoring result, calculating by 2-Delta CT relative quantification method and performing SPSS version 20.0 significance test of difference. The method is accurate, rapid, convenient and strong in applicability.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting LEPR A primer for the 127bp deletion alternative splice body of the gene, a kit containing the primer and a detection method. Background technique [0002] Leptin is mainly a small peptide hormone secreted by the white adipose tissue of non-avian vertebrates, which binds to the leptin receptor (LEPR) to exert its biological function. However, functional studies of LEPR are limited due to the lack of avian endogenous Leptin. Recently, birds Leptin The successful cloning of the gene has pushed the research of bird Leptin and LEPR to a new climax. birds LEPR The widespread expression characteristics of gene organization have been proved, but the identification and isolation of multiple alternative splicing forms are relatively slow, which will hinder the LEPR The study of the physiological function of genes. Therefore, it is of great significance to use mol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 刘小军王丹丹王台安蒋瑞瑞徐春林李转见田亚东康相涛
Owner HENAN AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More