A gene tafbk1 with f-box structure domain and its expression vector and application
An expression vector and domain technology, applied in the field of genetic engineering, can solve the problems of wheat yield reduction and grain failure, and achieve the effect of improving resistance and improving stripe rust resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Cloning of gene TaFBK1 with F-box domain induced by stripe rust in 92R137
[0027] 92R137 is a translocation line created by Nanjing Agricultural University by crossing tetraploid Triticum turgitum with diploid Triticum turgitum (Haynaldiavillosa) and backcrossing with hexaploid common wheat multiple times ( Chen, P.D., Qi, L.L., Zhou, B., S.Z. Zhang, D.J. Liu. 1995 Development and molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS / 6AL translocation lines specifying resistance to powdery mildew. TAG, (91): 1125-1128.). Chromosome 1B of 92R137 contains the wheat stripe rust resistance gene Yr26, which has a high resistance-immune level to dominant races 29, 31, and 32 in the highly virulent race (Chunmei Wang, Yiping Zhang, Dejun Han, Zhensheng Kang, Guiping Li, Aizhong Cao, Peidu Chen. SSR and STS markers for wheat stripe rust resistancegene Yr26. Euphytica, 2008, 159:359-366.).
[0028] In order to clone the resistance-related genes in the Yr26 di...
Embodiment 2
[0030] Example 2 Analysis of expression characteristics of TaFBK1 gene induced by stripe rust
[0031] In order to study the expression pattern of TaFBK1 in stripe rust-resistant materials, the RNA reverse transcription cDNA of the resistant material 92R137 and the susceptible material Yangmai 158 induced by stripe rust for 0, 6, 12, 24, and 72 hours were used as templates. Using P3 (GTTTGCTTGTTGTGCATTGG, SEQ ID NO.5) and P4 (CGCTTGCGACATTCAAGATA, SEQ ID NO.6) as primers for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCRMaster Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, a...
Embodiment 3
[0032] Example 3 Construction of TaFBK1 overexpression vector and its transformation into common wheat Yangmai 158 and identification of its resistance to stripe rust
[0033] Using the cDNA from 92R137 as a template, the primers P5 (ATCCCGGGTATGGTTGAGTGCACAATGG, SEQ ID NO.7) and P6 (ATAGGTACCGAGCCTAGATCTTCAGCAGA, SEQ ID NO.8) spanning the ORF were designed with the full-length sequence of the TaFBK1 gene, and P5 carried the SmaI enzyme Cutting site, P6 has KpnI restriction site. PCR amplification was performed using primer pairs P5 and P6, and amplified fragments were recovered. The amplified product was double digested with SmaI and KpnI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higherplants.EMBO J.1987,6:3901-3907.), put TaFBK1 at the multiple cloning site behind the 35S promoter, and replace the GUS gene carried by the vector itself....
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap