Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A small GTP binding protein gene tarab18 and its expression vector and application

A technology combining proteins and expression vectors, applied in the field of genetic engineering, can solve the problems of loss of variety resistance, single large-scale planting, etc., and achieve the effect of improving resistance and improving stripe rust resistance.

Inactive Publication Date: 2018-06-05
JIANGSU LIXIAHE REGION AGRI RES INST
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Breeding and promoting wheat disease-resistant varieties for many years has been the main means for plant disease scientists and breeders to solve and control wheat stripe rust. Although it is quite effective, due to the high genetic variability of wheat stripe rust The single and large-scale planting of the specific disease-resistant varieties of the upper race will inevitably lead to the emergence and development of new dominant races in the stripe rust population, and eventually lead to the loss of resistance of the original varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A small GTP binding protein gene tarab18 and its expression vector and application
  • A small GTP binding protein gene tarab18 and its expression vector and application
  • A small GTP binding protein gene tarab18 and its expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Cloning of the gene TaRab18 with GTP / GDP binding effect induced by stripe rust

[0027] In order to clone the resistance-related genes in the Yr26 disease resistance pathway, gene microarray hybridization was used to screen the differentially expressed genes in stripe rust-resistant wheat 92R137 and stripe rust-susceptible wheat Yangmai 158. An EST probe Ta.1763.2.S1_at with 10-fold up-regulated expression was obtained from multiple screenings. Based on this probe sequence, the amplification product of expected length was obtained by RACE ( figure 1 A), the sequence length after splicing is 1015bp. Full-length primers P1 (CCAGCCATGGACTCTTCTTC, SEQ ID NO.3) and P2 (AGCTGAAAGCTGCCAAGGTA, SEQ ID NO.4) were designed according to the spliced ​​sequence. Using the disease-resistant wheat 92R137cDNA as a template, an amplified product with an expected length of 826bp was obtained by RT-PCR ( figure 1 B), and it is recovered, cloned, and sequenced, and the amplifie...

Embodiment 2

[0028] Example 2 Analysis of expression characteristics of TaRab18 gene induced by stripe rust

[0029] In order to study the expression pattern of TaRab18 in stripe rust-resistant materials, the RNA reverse transcription cDNA of the resistant material 92R137 and the susceptible material Yangmai 158 induced by stripe rust for 0, 6, 12, 24, and 72 hours were used as templates. Using P3 (CGCAGCCGGACTTCGACTACC, SEQ ID NO.5) and P4 (CCCAGACGGCGAGCTTGAGC, SEQ ID NO.6) as primers for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCRMaster Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute...

Embodiment 3

[0030] Example 3 Construction of TaRab18 overexpression vector and its transformation into common wheat Yangmai 158 and identification of resistance to stripe rust

[0031]Using the cDNA from 92R137 as a template, the primers P5 (ATCCCGGGTATGGTTGAGTGCACAATGG, SEQ ID NO.7) and P6 (ATAGGTACCGAGCCTAGATCTTCAGCAGA, SEQ ID NO.8) spanning the ORF were designed with the full-length sequence of the TaRab18 gene, and P5 carried the enzyme of BamH1 Cutting site, P6 has KpnI restriction site. PCR amplification was performed using primer pairs P5 and P6, and amplified fragments were recovered. The amplified product was double digested with BamH1 and KpnI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higherplants.EMBO J.1987,6:3901-3907.), put TaRa b18 at the multiple cloning site behind the 35S promoter, and replace the GUS gene carried by the vector its...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and discloses a small GTP-binding protein gene TaRab18 and its expression vector and application. The cDNA sequence of the small GTP binding protein gene TaRab18 is SEQ ID NO.1 and the encoded amino acid sequence is SEQ ID NO.2. The gene is from common wheat (Triticum asetivum L.) 92R137. The expression of TaRab18 in the stripe rust-resistant wheat variety 92R137 was enhanced by stripe rust, and the expression level was much higher than that in the susceptible wheat variety Yangmai 158. The gene was inserted into pBI220 to obtain an overexpression vector, and transformed into the stripe rust-susceptible wheat variety Yangmai 158. The identification results of the T1 generation of positively transformed plants showed that the overexpression of TaRab18 could improve the stripe rust-susceptible wheat variety's resistance to stripe rust .

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a small GTP-binding protein gene TaRab18 and its expression vector and application. Background technique [0002] Wheat (Triticum aestivum L.) stripe rust is a serious wheat disease caused by wheat stripe rust (Puccinia striiformisf.sp.tritici), which commonly occurs in more than 60 countries and regions in the world. Wheat stripe rust mainly occurs on wheat leaves, but can also occur on leaf sheaths and stems, ear awns and glumes. Wheat stripe rust has the characteristics of strong explosiveness, high epidemic frequency, fast transmission speed, difficult prevention, wide occurrence range and serious damage. In general epidemic years, wheat stripe rust can reduce wheat yield by 20%-30%, while in pandemic years, the yield loss can reach 50%-60%, or even no harvest. my country is not only the largest endemic area of ​​wheat stripe rust in the world, but also a relatively independe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
Inventor 蒋正宁曹爱忠张伯桥高德荣别同德赵仁慧吴旭江
Owner JIANGSU LIXIAHE REGION AGRI RES INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More