Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Treponema pallidum p15-17-47 fusion protein and recombination expression method thereof

A fusion protein and protein technology, applied in the field of immunoassay medical diagnosis, can solve the problems that TP cannot be cultured in vitro and the research of antigen is difficult

Inactive Publication Date: 2015-04-29
GUANGZHOU KANGRUN BIOTECHNOLOGY CO LTD
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, on the one hand, due to the scarcity of TP membrane proteins and the fragility of the membrane structure itself, on the other hand, due to the characteristics of TP that cannot be cultured in vitro, the research on the characteristic antigens of TP has been difficult and full of controversy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treponema pallidum p15-17-47 fusion protein and recombination expression method thereof
  • Treponema pallidum p15-17-47 fusion protein and recombination expression method thereof
  • Treponema pallidum p15-17-47 fusion protein and recombination expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Syphilis Nihcols strain p15, p17 and p47 gene cloning

[0031] 1) Genomic DNA extraction: The Nihcols strain of syphilis was provided by the Guangdong Provincial Skin and Venereal Disease Prevention and Control Center, and the genomic DNA of Treponema pallidum was carried out according to the instructions of the Bacterial Genomic DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0032] 2) Primer design: Download the whole genome sequence of Treponema pallidum subsp.pallidum str. Nichols (Accession No.U73117.1) from Genbank, and select the gene sequences encoding 15KD, 17KD and 47KD proteins by Blast. Use Oligo6 software to design PCR amplification primers from both ends of the three gene sequences, and the primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The primer sequences are as follows:

[0033] Amplify p15 primer: upstream primer 1 is 5′-ATGGTGAAAAGAGGTGGCGCG-3′

[0034] Downstream primer 2 is 5...

Embodiment 2p15

[0049] Effective epitope analysis of three protein fragments of embodiment 2p15, p17 and p47

[0050] According to the whole genome sequence information of Treponema pallidum subsp.pallidum str.Nichols (Accession No.U73117.1) in Genbank, the amino acid sequences corresponding to the three protein fragments of p15, p17 and p47 were found. Amino acid sequences were used to predict the effective epitopes of the three protein fragments through the online epitope prediction server http: / / www.cbs.dtu.dk / services / BepiPred / . According to the prediction, select the 23-116 amino acids of the p15 fragment, corresponding to a DNA sequence of 67-348 bp; select the 30-145 amino acids of the p17 fragment, corresponding to a DNA sequence of 88-435 bp; select the 23-416 amino acids of the p47 fragment, corresponding The DNA sequence is 67-1248bp.

Embodiment 3

[0051] Example 3 Construction of recombinant plasmid pPIC9K-p15-17-47

[0052] 1) Design of primers for PCR amplification of effective epitopes: design primers based on the effective epitopes determined in Example 2. Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The primer sequences are as follows:

[0053] Amplify effective epitope p15 primers:

[0054] Upstream primer 7 is

[0055] 5′-TAAGAAT GCGGCCGC ATTCTATCCCGAATGG-3′

[0056] (The underline is the EcoR I restriction site)

[0057] Downstream primer 8 is

[0058] 5′- GGCGGCGGTGGCAGCGGCGGCGGTGGCAGC AGAAACAGTTGCACCGG-3′

[0059] (The underline is the positive chain of the flexible peptide sequence)

[0060] Amplify effective epitope p17 primers:

[0061] Upstream primer 9 is

[0062] 5′- GCTGCCACCGCCGCCGCTGCCACCGCCGCC CCGCACGCCGGGAAG-3′

[0063] (The underline is the negative chain of the flexible peptide sequence)

[0064] Downstream primer 10 is

[0065] 5′- GGCGGCGGTGGCAGCGGCGGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to treponema pallidum p15-17-47 fusion protein and a recombination expression method thereof, and belongs to the technical field of mechanical diagnosis of immunoassay. According to the technical scheme, the recombination expression method of treponema pallidum p15-17-47 fusion protein comprises the following steps in sequence: respectively performing PCR amplification for gene segments of p15, p17 and p47 three protein fragments in treponema Nihcols strains; analyzing effective epitopes of the three protein segments; amplifying and performing enzyme-cut and link up for the effective segments; building recombinant plasmid pPIC9k-p15-17-47 and recombinant saccharomycetes eukaryotic expressing system GS115pPIC9k-p15-17-47; performing liquid culture for recombinant yeast; and purifying recombinant expression products.

Description

technical field [0001] The invention relates to a Treponema pallidum p15-17-47 fusion protein based on cloning technology and a recombinant expression method thereof, belonging to the technical field of immunoanalysis medical diagnosis. Background technique [0002] Syphilis is a venereal disease caused by Treponema pallidum (TP), which has extremely complex clinical manifestations and can almost involve all organs of the body. In 1999, a total of 80,406 cases of syphilis were reported nationwide, and in 2009, 327,433 cases were reported, with an annual incidence rate of 24.66 / 100,000 and an average annual increase of 14.3%; the number of reported cases of congenital syphilis increased from 109 in 1997 to 10,757 in 2009 cases, with an average annual increase of 49.2%. Guangdong Province is the peak province of syphilis, accounting for more than 10% of the total number of national reports. In 2010, 45,399 cases of syphilis were reported in the province, with a reported inci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N1/19C12P21/02
Inventor 黄文喜章平谢文锋梁李新叶晶龙
Owner GUANGZHOU KANGRUN BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com