Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RT-HDA primer, kit and method for detecting tomato spotted wilt virus

A technology of tomato spotted wilt virus and kit is applied in the field of RT-HDA primers to achieve the effects of improving accuracy, high sensitivity and not easy non-specific amplification

Inactive Publication Date: 2015-03-25
INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, there is no research on the detection of plant viruses by HDA at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-HDA primer, kit and method for detecting tomato spotted wilt virus
  • RT-HDA primer, kit and method for detecting tomato spotted wilt virus
  • RT-HDA primer, kit and method for detecting tomato spotted wilt virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1 specificity experiment

[0041] (1) Primer design

[0042] The present invention is based on the N gene full-length sequence of TSWV in the NCBI nucleic acid sequence database ( KC294570.1 (Kunming isolate), HM581936.1 (Nanjing isolate), JF730744.1 (Korea isolate), HM180089 (Taiwan isolate), HQ406984.1 (US isolate), KC494503.1 (New Zealand isolate), KM379142 .1 (Turkey isolate), KF146703.1 (Venezuela isolate)), under the premise of guaranteeing the amalgamation and versatility of the amplification, by comparative analysis of the highly conserved region of the TSWV N gene, RT-HDA primers were designed for HD- For P1 and HD-P2, after the design is completed, the primers are compared and verified under the Primer-Blast module of the database, and finally the following RT-HDA detection primer sets are selected:

[0043] Upstream primer HD-P1: GGCTTGAATCAGAGGGTGAGA (see SEQ ID NO: 1 in the sequence listing),

[0044] Downstream primer HD-P2: TTGGAGCCACTGACAT...

Embodiment 2

[0053] Embodiment 2 Sensitivity experiment

[0054] (1) Use DEPC water to make 10-fold gradient dilution of TSWV virus RNA template solution downwards, successively 1.56×10 -1 , 1.56×10 -2 , 1.56×10 -3 , 1.56×10 -4 , 1.56×10 -5 , 1.56×10 -6 , 1.56×10 -7 ng / μL, 2 μL each was used as a template for RT-HDA and RT-PCR amplification reactions. Amplification primer sets consist of:

[0055] Upstream primer HD-P1: GGCTTGAATCAGAGGGTGAGA (see SEQ ID NO: 1 in the sequence listing),

[0056] Downstream primer HD-P2: TTGGAGCCACTGACATGACC (see SEQ ID NO: 2 in the sequence listing).

[0057] (2) Extraction of viral RNA

[0058] Take 0.1 g of samples with different dilution concentrations, add liquid nitrogen and grind them into powder, quickly transfer the ground material into a 1.5 mL centrifuge tube, add 1 mL Trizol Reagent, mix by inverting, 2 ° C ~ 8 ° C, 12000 g, centrifuge for 10 min. Take the supernatant, let stand at 15°C-30°C for 5min; add 0.2mL chloroform, shake vigorous...

Embodiment 3

[0068] Embodiment 3: Actual sample detection and comparative experiment

[0069] The disease samples and laboratory samples with typical TSWV symptoms collected from Yunnan, Shandong, Sichuan and other places were detected by RT-HDA and RT-PCR respectively, and the effects of the two methods were compared to further evaluate RT-HDA reliability of the method.

[0070] 1. RT-HDA detection of actual samples

[0071] 1) Extraction of viral RNA

[0072]Take 0.1g sample, grind it into powder with liquid nitrogen, quickly transfer the ground material into a 1.5mL centrifuge tube, add 1mL Trizol Reagent, mix by inversion, 2℃~8℃, 12000g, centrifuge for 10min. Take the supernatant, let stand at 15°C-30°C for 5min; add 0.2mL chloroform, shake vigorously by hand (do not vortex) for about 15s. 15℃~30℃, stand for 2min~3min; 2℃~8℃, 12000g, centrifuge for 15min. Carefully pipette approximately 600 μL of the upper aqueous phase without disturbing the middle and lower phases. Add 500 μL of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RT-HDA primer, kit and method for detecting a tomato spotted wilt virus. The primer is an oligonucleotide sequence represented by SEQ ID NO:1 and SEQ ID NO:2 of a sequence table. The kit comprises the following components: RT-HDA amplified reaction liquid, deionized water without RNA enzyme, a positive control sample and a negative control sample, the deionized water is adopted as blank control, the positive control sample is an RNA template with the tomato spotted wilt virus, and the negative control sample is a healthy tomato tissue RNA template without the tomato spotted wilt virus. The detecting method comprises the following steps that (1) RNA extraction is carried out on a sample to be detected; (2) RT-HDA amplification is carried out on the RNA of the tomato spotted wilt virus; (3) an electrophoresis detecting result is described and judged. The HDA detecting method is faster, safe and reliable, and compared with a PCR, no PCR instrument is needed, the requirement for equipment is simple, the method is suitable for fast detecting and confirming the tomato spotted wilt virus, and the method can be widely applied to epidemic situation monitoring in agricultural production and environment and monitoring and detecting of this kind of viruses in import and export trade.

Description

technical field [0001] The invention relates to an RT-HDA primer for detecting tomato spotted wilt virus, a kit and a method, and belongs to the technical field of virus detection. Background technique [0002] In recent years, Tomato spotted wilt virus (TSWV) has been listed as one of the ten most harmful plant viruses in the world due to its wide host range and huge economic losses. In the 1960s to 1980s, the virus was prevalent in tobacco and tomato in Europe, America and Africa, with an annual incidence rate of 20% to 50%, causing losses of up to several billion dollars. In Hawaii, Brazil, Italy and South Africa, the prevalence of TSWV in the 1980s and 1990s led to near extinction of crops such as tomato and lettuce. In recent years, Tomato spotted wilt virus, especially TSWV, has become an important factor causing great economic losses of various commercial crops and ornamental plants all over the world. [0003] Many vegetable seeds such as peppers, onions, and lettu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/701C12Q1/686C12Q2521/101
Inventor 吴兴海陈长法魏晓棠纪瑛林超唐静宋涛王英超
Owner INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com