Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid molecule binding to influenza virus and use therefor

A technology for nucleic acid molecules and influenza viruses, which is applied in the field of nucleic acid molecules combined with influenza viruses and their applications, and can solve the problems of insufficient binding ability of nucleic acid molecules

Inactive Publication Date: 2015-02-18
NEC SOLUTION INNOVATORS LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, previously reported nucleic acid molecules that bind to influenza virus have insufficient binding capacity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid molecule binding to influenza virus and use therefor
  • Nucleic acid molecule binding to influenza virus and use therefor
  • Nucleic acid molecule binding to influenza virus and use therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment A1

[0186] Aptamers capable of binding to influenza virus were prepared, and the ability of each aptamer to bind to influenza virus-derived HA was examined.

[0187] (1) Aptamer

[0188] As aptamers of this example, the following polynucleotides were synthesized.

[0189] RHA0002 (SEQ ID NO: 12)

[0190] GGTTAGCCCGTCCCGAGATAACTCGGGGTGTTTGATGGTTTGGTCTGGTTGGCTTAACACACGGCGGCTGTAG

[0191] RHA0006 (SEQ ID NO: 18)

[0192] GGTTAGCCCGTCCCGAGATAACTCGGTGTGTTGGGTTTGGGTTGGGTTGGGTCTTAACACACGGCGGCTGTAG

[0193] RHA0111 (SEQ ID NO: 28)

[0194] CCTGCACCCAGTGTCCCGTGCTCCGGGGGTTGGGCGTGGTGGGTCTGTCGGGTTTCGGACGGAGAGGAGGACGG

[0195] RHA0127 (SEQ ID NO: 29)

[0196] CCTGCACCCAGTGTCCCTGGGTCGGCTAATTTGGCATTTGGGGTGGTTTGGGGGGGGGACGGAGAGGAGGACGG

[0197] A DNA library comprising a plurality of DNAs was prepared as Comparative Example N30, each DNA represented by an oligonucleotide of SEQ ID NO: 34 (which includes a random sequence of 30-mers (N) 30 )composition. Moreover, a DNA library comprising ...

Embodiment A2

[0254] This example examines the binding ability of the aptamer obtained by truncating RHA0002 (SEQ ID NO: 12) to HA.

[0255] (1) Aptamer

[0256] RHA0002 (SEQ ID NO: 12) shown below and its truncated aptamer were synthesized.

[0257] RHA0002 (SEQ ID NO: 12)

[0258] GGTTAGCCCGTCCCGAGATAAC TCGGGGTGTTTGATGGTTTGG TCTGGTTGG CTTAACACACGGCGGCTGTAG

[0259] RHA0002_s33 (SEQ ID NO: 17)

[0260] GTGTTTGATGGTTTGGTCTGGTTGGCTTAACAC

[0261] (2) Binding ability analysis by SPR

[0262] Except for using the above aptamers, the binding ability to the target protein was analyzed in the same manner as in Example A1. The results are shown in Table 1 below. In Table 1, relative values ​​were determined in the same manner as in item (3) of Example A1.

[0263] [Table 1]

[0264]

[0265] As can be seen from Table 1, the truncated aptamers showed binding ability to each target protein. In particular, RHA0002_s33 (SEQ ID NO: 17) showed improved binding ability by truncation.

Embodiment A3

[0267] This example examines the binding ability of RHA0006 (SEQ ID NO: 18), a truncated aptamer obtained by truncating RHA0006, and an aptamer including two truncated sequences of the truncated aptamer to HA.

[0268] (1) Aptamer

[0269] RHA0006 (SEQ ID NO: 18)

[0270] GGTTAGCCCGTCCCGAGATAACTCGGTGTGTTGGGTTTGGGTTGGGTTGGGTCTTAACACACGGCGGCTGTAG

[0271] RHA0006_s19 (SEQ ID NO: 19)

[0272] GGGTTTGGGTTGGGTTGGG

[0273] RHA0006_s19_d9 (SEQ ID NO: 32)

[0274] GGGTTTGGGTTGGGTTGGG TTTTTTTTT GGGTTTGGGTTGGGT TGGG

[0275] (2) Binding ability analysis by SPR

[0276] Except for using the above aptamers, the binding ability to the target protein was analyzed in the same manner as in Example A1. The results are shown in Table 2 below. In Table 2, relative values ​​were determined in the same manner as in item (3) of Example A1.

[0277] [Table 2]

[0278]

[0279] As can be seen from Table 2, the truncated aptamers and the aptamers having two truncated sequences each ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a nucleic acid molecule that can be utilized to detect the influenza virus. A nucleic acid molecule containing any of the polynucleotides (a)-(d) below is taken as a nucleic acid molecule that binds to the influenza virus. (a) A polynucleotide composed of a base sequence of any of SEQ ID NO: 1-30; (b) a polynucleotide that binds to the influenza virus, composed of a base sequence in which one or more bases have been deleted, substituted, inserted and / or added in any of the base sequences of (a) above; (c) a polynucleotide that binds to the influenza virus, composed of a base sequence having 80% or higher identity with any of the base sequences of (a) above; (d) a polynucleotide that binds to the influenza virus, composed of a base sequence complementary to a polynucleotide that hybridizes with a polynucleotide composed of any of the base sequences of (a) above under stringent conditions.

Description

technical field [0001] The present invention relates to nucleic acid molecules that bind influenza virus and uses thereof. Background technique [0002] The spread of seasonal influenza virus and novel influenza virus infection has been observed in recent years, thus influenza virus detection has become more and more important. [0003] In influenza virus detection, for example, a method using gene amplification or a method using antibodies has been employed. The former is a method in which nucleic acid in a sample is subjected to PCR or the like to amplify a base sequence unique to influenza virus and the presence or absence of influenza virus infection is determined according to whether amplification occurs. However, in order to accomplish gene amplification, it is necessary, for example, to pretreat samples collected from human bodies, which is time-consuming and laborious. Furthermore, there is also a problem of false positive errors due to amplification of similar seq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115
CPCC12N2310/16C12N15/115C12Q1/701C12Q2600/112
Inventor 白鸟行大秋富穰堀井克纪古市真木雄和贺岩
Owner NEC SOLUTION INNOVATORS LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com