Biosynthesis method of glucuronic acid and glucuric acid
A technology of glucuronic acid and aldol dehydrogenase, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., to achieve the effect of efficient production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The construction of embodiment 1 recombinant escherichia coli
[0027] Using the genomes of Pichia pastoris GS115 and Pseudomonas putida KT2440 as templates respectively, MIOX and Udh were obtained, and the primer for amplifying the MIOX gene was F1 (the nucleotide sequence is shown in SEQ ID NO.5 ), R1 (nucleotide sequence as shown in SEQ ID NO.6), the primers for amplifying the Udh gene are F2 (nucleotide sequence as shown in SEQ ID NO.7), R2 (nucleotide sequence as shown in SEQ ID NO.7) shown in NO.8). The primers are as follows (the underlined part is the primer restriction site):
[0028] MIOX
[0029] F1: CGC GGATCC GTAAAAGGAGAAAAAAAATGTCAGTACAAAAAAAGCACGAAG
[0030] R1: CCG GAATTC TCAAAACTTTACCAGCTTTTGAGG
[0031] Udh
[0032] F2: GGAATTC CATATG ACCACTACCCCCCTTCAATC
[0033] R2: CCG CTCGAG TTAGTTGAACGGGCCGGCCACGGC
[0034] Digest the fragment containing the MIOX gene with the corresponding restriction endonuclease, and connect it with the expressio...
Embodiment 2
[0036]Embodiment 2 Recombinant Escherichia coli fermentation produces glucuronic acid and glucaric acid
[0037] Pick a single colony from the LB plate containing Kana antibiotic resistance and inoculate it into a Erlenmeyer flask for culture. The liquid volume is 25mL / 250mL, and cultured at 37°C and 200r / min for 10-14h. Transfer the cultivated seed culture solution to a 500mL Erlenmeyer flask containing 50mL of inositol-containing fermentation medium according to the inoculum amount of 1%, and cultivate at 37°C and 200rmin-1. The bacterium grew to OD600=0.6, and was induced by adding 0.1 mM IPTG, and at the same time adjusted the temperature to 30° C., and continued to cultivate for 48 h. After the cultivation, 1ml of the fermentation broth was centrifuged at 8000rpm for 10min, and the supernatant was filtered through a 0.22um filter membrane, and the product was detected by LC-MS. Such as Figure 1-4 as shown, figure 1 , figure 2 They are the LC-MS detection charts of g...
Embodiment 3
[0038] Embodiment 3 recombinant escherichia coli fermentation produces the method for glucuronic acid or glucaric acid
[0039] 1. Strains: E.coli BL21(DE3) / pRSFD-MIOX (for the synthesis of glucuronic acid) and E.coli BL21(DE3) / pRSFD-MIOX-Udh (for the synthesis of glucuronic acid)
[0040] 2. Culture medium:
[0041] Seed medium: LB medium (peptone 10g / L, sodium chloride 10g / L yeast powder 5g / L)
[0042] Fermentation medium: LB-MI medium (60 mM inositol was added to LB medium).
[0043] If necessary, add Kan50 mg / L of Kanna antibiotics to the culture medium.
[0044] 3. Training conditions:
[0045] (1) Seed culture: Pick a single colony from the LB plate containing Kana antibiotic resistance and inoculate it into a Erlenmeyer flask for culture. The liquid volume is 25mL / 250mL, and cultured at 37°C and 200r / min for 10-14h.
[0046] (2) Shake flask fermentation culture: Transfer the cultivated seed culture solution to a 500mL Erlenmeyer flask containing 50mL fermentation me...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com