Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Feline long-acting fusion interferon and its preparation method and application

A technology of interferon and fusion protein, applied in biochemical equipment and methods, chemical instruments and methods, and methods based on microorganisms, etc., can solve complex problems, achieve product cost reduction, improve therapeutic effect, and simple protein purification process Effect

Active Publication Date: 2017-06-16
CHANGCHUN SR BIOLOGICAL TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of fusion proteins of INFα and HSA is extremely complicated. How to design the structure of the fusion protein so that both can maintain relatively independent biological activities; how to construct a high-expression strain and separate and prepare a high-purity fusion protein. Fusion protein structure and biological function identification need to be fully studied
At present, there is no method of prolonging the half-life of interferon by fusion protein in the application of interferon in dogs and cats

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Feline long-acting fusion interferon and its preparation method and application
  • Feline long-acting fusion interferon and its preparation method and application
  • Feline long-acting fusion interferon and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Preparation of dog and cat long-acting fusion interferon

[0028] CSA, FSA, cIFN, and fIFN were used to construct recombinant dog and cat serum albumin-interferon fusion protein expression vectors.

[0029] Preparation steps of dog and cat serum albumin-interferon fusion protein:

[0030] 1. Refer to the open reading frame of canine serum albumin (CSA) gene (NM_001003026.1) and cat serum albumin (FSA) gene (NM_001009961.1) and the physical map of yeast expression vector pPIC3.5k to design primers and introduce restriction sites In the meantime, the natural signal peptide of serum albumin is retained, the stop codon of serum albumin is removed, and the signal peptide of interferon and the start codon are removed.

[0031] (1) CSA upstream primer:

[0032] CSA1:

[0033] 5`-GC GAATTC GCCATGAAGTGGGTAACTTTTATTTCCCTC TTCTTTC-3`, where the 5` end contains EcoRI restriction site;

[0034] CSA downstream primer:

[0035] CSA2:

[0036] 5`- TAGGATCCACCACCACCG ACTAAGGCAGCTTGAGCAG ...

Embodiment 2

[0080] Example 2 Detection of activity of dog and cat long-acting fusion interferon

[0081] 1. In vitro biological activity detection: the in vitro biological activity of dog and cat long-acting fusion interferon was detected by WISH-VSV microcytopathic inhibition method, and the cell count was 2.5×105~3.5×105 cells / ml WISH cell suspension Seed on 96-well cell plate, 100μl per well, 37℃, 5% CO 2 Cultivate for 4-6h under conditions. Prepare complete culture medium: 10% bovine serum MEM, assay culture medium: 7% bovine serum MEM, challenge culture medium: 3% bovine serum MEM. Dilute the standard sample to 103IU / ml with the assay culture solution, and then dilute the standard sample diluent and the induced culture supernatant to be tested at a 4-fold ratio, to a total dilution of 412 times. Add the positive control standard diluted multiple times and the induced culture supernatant to be tested into a 96-well plate that has been plated with WISH cells according to the correspondin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein formed by a cat serum albumin and an interferon. An amino acid sequence is shown in SEQ ID No 2. A cat long-acting fusion interferon is capable of prolonging half-life of the interferon, improving biological activity of the interferon in an animal body and lowering cost of an interferon medical preparation and is applied to controlling work of diseases of animals such as cats.

Description

Technical field [0001] The invention relates to the technical field of prevention and treatment of animal diseases, in particular to cat long-acting fusion interferon and its preparation method and application. Background technique [0002] Interferon (Interferon, IFN) is an important type of cytokine. It is a secreted glycoprotein produced by biological cells by viruses or other heterologous substance inducers. It has anti-virus, inhibits cell proliferation, immune regulation, etc. A variety of biological effects have good therapeutic effects on viral diseases, bacterial diseases, tumors and other diseases. However, interferon has a short half-life in clinical application and is prone to degradation in the body. These problems limit the full play of the biological effects of interferon and directly affect the effective application of interferon in clinical practice. So how to extend the half-life of interferon and improve the interference The effect of the biological activity o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N1/19A61K38/21A61K47/64A61P35/00A61P31/12C12R1/84
Inventor 夏振强郑文文夏晓红金宏丽王照黄靖陈宪平付玉
Owner CHANGCHUN SR BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com