Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for interleukin 6

An interleukin and kit technology, applied in the field of molecular immunology, can solve the problems of out of control and long reaction time.

Active Publication Date: 2014-08-06
BEIJING PERGRANDE BIOTECH DEV
View PDF8 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, if the inflammatory response is excessive or the reaction time is too long due to infection, re-injury, etc., the body will synthesize and release too many inflammatory mediators, which will cause an out-of-control and gradually enlarged chain reaction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for interleukin 6
  • Detection kit for interleukin 6
  • Detection kit for interleukin 6

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The preparation of embodiment 1.IL-6 recombinant protein

[0030] The IL-6 coding sequence was obtained from the NCBI database, and the prokaryotic expression vector pET32-IL6 was constructed to induce the expression of IL-6 recombinant antigen. The protein was immunoreactive by Western blot analysis, and a large amount of IL-6 recombinant protein was prepared by purification on a nickel affinity chromatography column. , the protein can be used for the preparation of antibodies.

[0031] 1. Construction of pET28-IL-6 expression vector

[0032] The IL-6 gene was purchased from Wuhan Sanying Biotechnology Co., Ltd., and primers were designed with reference to the IL-6 cDNA sequence:

[0033] IL-6-F: cgggatccccagtacccccaggag (SEQ ID No. 1) and

[0034] IL-6-R: ccgctcgagctacatttgccgaag (SEQ ID No. 2).

[0035] PCR amplification of IL-6 gene, PCR system:

[0036]

[0037] PCR program:

[0038] 94℃10min 1 cycle

[0039] 94°C 30s, 55°C 30s, 72°C 30s 30 cycles

[0040...

Embodiment 2

[0056] Example 2. Preparation and identification of monoclonal antibodies

[0057] 1. Immunization of Balb / c mice

[0058] Select 6-week-old female Balb / c mice with a body weight of about 20 g, and for the first immunization, take the above-mentioned IL-620-50 μg plus Freund's complete adjuvant and inject them subcutaneously at multiple points, and perform the second and third injections on the 14th and 28th days The dosage of the second immunization is the same as above, and intraperitoneal injection with Freund's incomplete adjuvant is added. The immunization is boosted 3 days before the fusion, and the dose is 20-50 μg. After 3 days, the spleen is taken for fusion.

[0059] 2. Steps of Cell Fusion

[0060] Preparation of feeder cell layer: Take a non-immunized Balb / c mouse, 6 weeks old, kill it by pulling the neck, soak it in 75% alcohol for 5 minutes, cut the skin with sterile scissors, expose the peritoneum, inject 6ml with a sterile syringe Pre-cooled culture solution ...

Embodiment 3

[0071] Example 3. Mass production of monoclonal antibodies

[0072] Have 2 monoclonal antibody hybridoma cell lines: take 1×10 7The concentration of cells was injected into the peritoneal cavity of Balb / c mice, and the ascites fluid was collected 10 days later. Monoclonal antibodies are purified by the following steps:

[0073] 1. The collected ascites was centrifuged at 2500 rpm, and the supernatant was taken. Add an equal volume of PBS (pH7.4) and 1 / 2 volume of saturated ammonium sulfate, and let stand at 4°C for 30 minutes;

[0074] 2. Centrifuge at 3000rpm, 4°C for 20min;

[0075] 3. Remove precipitation, add an equal volume of saturated ammonium sulfate to the supernatant, and let it stand for 30 minutes;

[0076] 4. Centrifuge at 3000rpm, 4°C for 20min;

[0077] 5. Take the precipitate, add 5ml normal saline and 5ml saturated ammonium sulfate and let stand for 30min;

[0078] 6. Centrifuge at 3000rpm, 4°C for 20min;

[0079] 7. Add 5ml of normal saline and 5ml of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention relates to a detection kit for interleukin 6. The detection kit comprises two specific monoclonal antibodies of the interleukin 6; one monoclonal antibody covering a perforated plate, the other monoclonal antibody labeled by biotin and the interleukin 6 of a sample to be detected form a sandwich compound structure of covering antibody-antigen-biotin labeled antibody; the biotin labeled on the antibody combines with streptavidin labeled by HRP, and then the HRP reacts with a substrate to generate a signal which is used for conducting quantitative analysis on the interleukin 6. The detection kit can quantitatively detect the content of the interleukin 6 in the sample rapidly and sensitively.

Description

technical field [0001] The invention belongs to the field of molecular immunology, in particular to a kit for detecting the protein content of interleukin 6 (IL-6). Background technique [0002] After the body is subjected to different types of trauma and stimulation, it will appear a state similar to an inflammatory response, that is, systemic inflammatory response syndrome (SIRS). In this process, injury factors stimulate the body's inflammatory cells to release inflammatory mediators. Normally, as a defense mechanism, it is beneficial to the recovery of the body after trauma, and will subside on its own as the trauma heals. However, if the inflammatory response is excessive or the reaction time is too long due to infection, re-injury, etc., the body will synthesize and release too many inflammatory mediators, which will cause an out-of-control and progressively enlarged chain reaction. The body enters into an adverse general state, showing moderate to severe SIRS. As th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577C07K16/24C12N5/20C12R1/91
CPCC07K16/24G01N33/543G01N33/577G01N33/6869C07K16/248G01N2333/5412
Inventor 于晖李雨心王旭陈勤慧李鑫刘琦李丽萍
Owner BEIJING PERGRANDE BIOTECH DEV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com