Preparation method of chimeric vaccine by using Ii-Key active tetrapeptide carrying Fabricius bursa VP2 and newcastle disease HN antigen peptide epitope
A chimeric vaccine and bursa of fabric technology, applied in chemical instruments and methods, viral antigen components, peptides, etc., to achieve good immune effect, easy preparation, and strong specificity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0045] Below by embodiment the present invention will be further described, but do not limit the present invention.
[0046] The experimental methods in the following examples are conventional methods unless otherwise specified.
[0047] The percentages in the following examples are all mass percentages unless otherwise specified.
[0048] The proportions in the following examples are volume proportions unless otherwise specified.
[0049] 1. Chimera design and gene synthesis
[0050] Design VP2 first 197-209 and HN 345-353 The tandem epitope, the epitope is linked by AAY linking peptide (Ala-Ala-Tyr), and the Ii-Key is then linked with the above tandem epitope. The specific sequence is as follows: 5'-CG gaattc CTTCGCATGAAGGCCGCCTACTGTGACAGCAGTGACAGGCCCAGAGTCTACACTATAACTGCCGCCTACGATGGACAAGATTACCAAATTCGGTGA gtcgac gcGT-3'
[0051] EcoR I was added at the 5' end of the gene sequence, a stop codon TGA and a SalI restriction site were added at the 3' end, the whole gene w...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com