Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder

A technology for liquid milk and milk powder, applied in the field of molecular biology, can solve the problems of easy degradation, time-consuming and low DNA concentration, and achieve the effect of preventing DNA degradation

Active Publication Date: 2014-06-25
黑龙江红星集团食品有限公司
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are a lot of proteins and lipids in cow's milk and goat's milk. Using traditional methods to extract DNA is not only cumbersome and time-consuming, but phenol / chloroform is easy to volatilize strong carcinogens, which is quite harmful to the body of the experimenters, and the concentration of extracted DNA is low. , high protein ratio, easy to degrade, not easy to store for a long time, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder
  • Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder
  • Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Milk, goat milk and milk powder genomic DNA extraction steps are as follows:

[0038] Step 1, reagent preparation and experimental equipment preparation:

[0039] 1. The centrifuge tube is prepared to use a 2ml centrifuge tube, sterilized in an autoclave, and set aside;

[0040] 2. PBS (phosphate buffer solution) is prepared as follows: Phosphate buffer solution (pBs): Weigh NaCL8g, KCL0.2g, NaCL 2 HPO 4 1.44g, K 2 HPO 4 0.24g, dissolve various substances in 800mL double distilled water, adjust the pH to 7.4, add double distilled water to make the volume to 1L;

[0041]3. Preparation of 5-10% Chelex-100 suspension: Weigh Chelex-1005-10g, dissolve in 95-90ml double distilled water, and shake well before use;

[0042] 4. Preparation of TE buffer solution: Weigh 1M / LTris-cl0.5M / L and EDTA-Na0.5M / LPH with a pH of 8.0 and adjust them to 7.0-8.0.

[0043] Step 2, leukocyte collection

[0044] ① Dissolve 1-2ml of milk or goat milk, or 2mg of milk powder in 2ml...

Embodiment 2

[0060] This example purchases fresh liquid milk from Xingniu Dairy Co., Ltd. of Animal Husbandry of Shandong Academy of Agricultural Sciences: milk and goat's milk, and purchases liquid milk and milk powder such as pure milk, pure goat's milk, yogurt and so on of different brands from major shopping malls in Jinan according to the present invention Genomic DNA in milk samples was extracted using the method, and the extracted genome was detected using Nanodrp (micro-ultraviolet spectrophotometer). The data obtained are shown in Table 1. For agarose gel electrophoresis, see figure 1 .

[0061] Table 1 Milk sample DNA purity and concentration determination results

[0062]

[0063] It can be seen from Table 1 that OD 260 / 280 If the value is within the range of 1.8-2.0, the DNA purity meets the requirements, and the purity and concentration of the genomic DNA of various types of milk extracted by the present invention can meet the requirements, but the concentration is signifi...

Embodiment 3

[0065] Ordinary PCR to detect the purification effect of DNA extraction:

[0066] This example uses the genomic DNA extracted from different brands of liquid milk and milk powder in Example 2 as a template, selects the mitochondrial 16SrRNA gene as the research object, searches for the gene sequence in GeneBank, and designs specific universal primers for cattle or sheep , carry out PCR amplification, and detect the amplification effect.

[0067] 1. Primer sequence:

[0068] Forward primer: AAGACGAGAAGGGAACCCTTGGAC

[0069] Reverse primer: GCGCTGTTTAATCCCCATAGG

[0070] 2. PCR reaction

[0071] (1) Perform PCR amplification with the liquid milk and milk powder genomic DNA of different brands extracted in Example 2 as a template, and the 25 μL reaction system includes the following solutions or reagents:

[0072]

[0073] (2) After exploring the experimental conditions by gradient PCR, the annealing temperature was finally determined to be 58°C, and the PCR reaction condi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biological technologies, particularly relates to the field of technologies of extracting DNA (Desoxvribose Nucleic Acid) from cattle and goat milk and milk powder, and discloses a method for rapidly and efficiently extracting DNA from cattle and goat liquid milk and milk powder. A Chelex-100 process and a Glassmilk (glass milk) DNA purification technology are perfectly combined and applied to extraction of trace DNA from cattle and goat liquid milk and milk powder for the first time. The collecting quantity of fresh liquid milk can be controlled to be 1-2 ml, the quantity of the milk powder can be controlled to be 1-10 mg, and the extracted DNA is high in concentration, extremely high in purity, and stable without being easily degraded. The extracted DNA can amplify more than 500-1000bp of a long-fragment gene sequence, and the obtained sequence is capable of developing subsequent molecular biology analysis. The method is simple in operation, low in consumption, short in time consumption, high in DNA purity, difficult in degradation, and convenient and practical in sampling; and the problem of difficulty in sampling blood and tissue can be prevented, no animal strsss reaction can be caused, and unnecessary loss caused by other sampling methods to the dairy enterprise and farmers is reduced.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for quickly and efficiently extracting DNA from liquid milk and milk powder of cattle and sheep. Background technique [0002] In molecular biology experiments, DNA extraction is the most basic and most commonly used technique. For dairy cows or dairy goats, the current materials for separating DNA mainly include tissue and blood. The ear clipping method is mainly used for tissue collection, and the tail vein blood collection is mainly used for blood collection. We found in production practice that these two methods will cause stress to experimental animals and affect the production level of dairy cows and dairy goats. On the one hand, it may cause deviations in experimental results; on the other hand, it is also a fortune for experimental cattle farms small loss. Therefore, it is particularly important to find a DNA extraction method that produces minimal st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
Inventor 步迅张全芳刘艳艳
Owner 黑龙江红星集团食品有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com