DNA (deoxyribonucleic acid) detection method for quickly distinguishing transgenic plant and product thereof
A technology for transgenic plants and detection methods, which is applied in the field of DNA detection for quickly distinguishing transgenic plants and their products, can solve the problems of indistinguishability, different transgene insertion sites, and inability to distinguish transgenic insect-resistant corn, etc., achieving simple experimental methods and theoretical The effect of a solid foundation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The invention is illustrated below with the transgenic alfalfa as an example. In the transgenic alfalfa, the target gene barley sodium hydrogen ion convective pump (HvNHX1) was introduced into the alfalfa genome by the Agrobacterium Ti plasmid, and four transgenic alfalfa lines were independently generated. The structural diagram of the transgenic Agrobacterium binary plasmid Figure 4 .
[0034] The primer sequences for amplifying the upstream and downstream host DNA of the transgene are as follows:
[0035] Kn1: ccagctggcgtaatagcgaagagg
[0036] Kn2: ggctttccccgtcaagctctaaa
[0037] Kn3: cgttggagtccacgttcttt
[0038] Kn4: tttgaacgcgcaataatggtttct
[0039]Kn5:agttccaaacgtaaaacggcttgt
[0040] Kn6: ctcccttaattctccgctca
[0041] The sequence of the degenerate nucleotide primer is as follows:
[0042] De: NGCSATSATWSGGTWA
[0043] Where: N=A,C,G,T; S=G,C; W=A,T.
[0044] The transgenic alfalfa DNA was first extracted, and then the adjacent DNA sequence of the tr...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com