Cancer suppressor gene ATOH8 and application of encoding protein thereof
A gene and coding technology, which is applied in the application field of tumor suppressor gene ATOH8 and its encoded protein, can solve the problem that the surface markers of tumor stem cells are poorly understood.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 ATOH8 is down-regulated in liver cancer tissue
[0028] 1. RNA-seq high-throughput sequencing
[0029] By extracting the RNA of 3 pairs of liver cancer patients' cancer tissues and their corresponding paracancerous tissues for high-throughput sequencing, it was found that ATOH8 was all lowly expressed in the cancer tissues of the 3 pairs of patients. The result is as figure 1 As shown: 448N(41) indicates that the reading of 448 samples of paracancerous tissue is 41; 448T(1) indicates that the reading of 448 samples of cancer tissue is 1; 473N(29) indicates that the reading of 473 samples of cancer tissue is 1; 473T(3) means that the reading of 473 samples of cancer tissue in the sample is 3; 510N(39) means that the reading of 510 samples of adjacent tissue is 39 ; 510T(3) indicates that the reading of 510 sample cancer tissues in the sample is 3.
[0030] 2. qRT-PCR detection of the expression of ATOH8 in clinical specimens of liver cancer patients
[0031...
Embodiment 2
[0040] Example 2 The Inhibitory Effect of ATOH8 on Stem Cell Pluripotency Gene
[0041] 1. Construction of a stable ATOH8 overexpressed cell line
[0042] Liver cancer cell lines Huh7 (Hokkaido University, Japan) and PLC8024 (Wuhan Institute of Virology, Chinese Academy of Sciences) were cultured in DMEM medium (DMEM; Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) in a carbon dioxide incubator at 37°C .
[0043] ① Construct the expression plasmid of ATOH8
[0044] The full-length cDNA sequence of ATOH8 was amplified by PCR, and the primer sequences were as follows:
[0045] F: CGCAAATGGGCGGTAGGCGTG (SEQ ID NO. 1);
[0046] R: ACCGAGGAGAGGGTTAGGGAT (SEQ ID NO. 2).
[0047] Construct the purified ATOH8 full-length sequence into pLenti6 / V5- On the expression vector (Invitrogen, K4950-00), the ATOH8 expression plasmid pLenti6-ATOH8 was obtained.
[0048] ② Transfection of liver cancer cells
[0049] The obtained pLenti6-ATOH8 and the pLenti6 empty vector (p...
Embodiment 3A
[0072] Example 3 ATOH8 inhibits the growth, migration and metastasis of liver cancer cells
[0073] In this example, the cells used in the experimental group were PLC8024 and Huh7 cell lines (8024-ATOH8, Huh7-ATOH8) overexpressing ATOH8 treated with pLenti6-ATOH8 as described in Example 2, and the cells used in the control group were blank vector pLenti6-vector Processed PLC8024 and Huh7 cell lines (8024-Vec, Huh7-Vec).
[0074] 1. Cell growth experiment
[0075] Changes in the growth rate of cells overexpressing ATOH8 were detected by the content of XTT. The experimental operation was carried out according to the instructions of the cell proliferation XTT kit (Roche, Mannheim). The brief description is as follows: Cells in the experimental group or control group were divided into 1×10 4 Cells / well were inoculated in 24-well culture plates, and XTT labeling mixture with a final concentration of 100 μl of 0.3 mg / mL was added to a group of cells every 24 hours, and the OD val...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com