LAMP (Loop-Mediated Isothermal Amplification) kit for detecting main subtype avian leukemia virus

A technology of avian leukosis virus and a kit, which is applied in the field of detection of avian leukosis virus, can solve problems such as aerosol pollution, inability to determine accurate detection results, etc., and achieve the effect of rapid detection

Active Publication Date: 2014-03-12
GUANGXI UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Even so, the LAMP method used in the previous technology still needs to add the dye after 1 hour to judge the result. The fluorescent dye syber-green added in the reaction needs to be analyzed and visualized by agarose gel electrophoresis ultraviolet light, and there is an open-cap run electrophoresis observation. The aerosol pollution caused by the lack of real-time monitoring of the reaction is difficult to eliminate these interference factors, and it is impossible to make an accurate judgment on the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-Mediated Isothermal Amplification) kit for detecting main subtype avian leukemia virus
  • LAMP (Loop-Mediated Isothermal Amplification) kit for detecting main subtype avian leukemia virus
  • LAMP (Loop-Mediated Isothermal Amplification) kit for detecting main subtype avian leukemia virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] 1. Preparation of materials

[0022] Avian leukosis virus A subtype, B subtype, E subtype and J subtype are all preserved by the poultry disease room of Guangxi University. The LAMP method DNA amplification kit (loopamp DNA amplification kit) was purchased from Beijing Lanpu Biotechnology Co., Ltd.

[0023] 2. Design and synthesis of LAMP primers

[0024] According to the POL gene sequence of avian leukosis virus in GenBank, a set of LAMP primers was designed by using the LAMP method primer-assisted design software PrimerExplorer V4 software, wherein F3 / B3 are outer primers and FIP / BIP are inner primers, as follows:

[0025] The sequence of the internal primer FIP is CTACATTAGTGGGCGCTGTCGGAACAACTGGAAGCACGCG (see the sequence listing SEQ.ID.No.1),

[0026] The sequence of the internal primer BIP is TCAAGATGGGACAGGAGGGAGTTTTGGCTTAACGCATCCTCT (see SEQ.ID.No.2 in the sequence listing);

[0027] The sequence of the outer primer F3 is TGATTTGGGGGCAAGTGTAC (see SEQ.ID.No.3 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) kit for detecting a main subtype avian leukemia virus. A loop-mediated isothermal amplification (LAMP) technology is adopted, and two pairs of specific primers (inner primers FIP and BIP, outer primers F3 and B3) are designed according to a POL (Point Of Load) gene sequence of the avian leukemia virus. By applying the LAMP kit and a detecting method established by the LAMP kit, an LAMP real-time turbidity meter is utilized to carry out real-time, quantitative and whole-course sealed monitoring analysis on LAMP reaction primers of the ALV (Avian Leukemia Virus), a reaction system and a reaction process, so that LAMP primers of the ALV are efficiently and specifically amplified. The LAMP kit disclosed by the invention has the advantages that the specificity is strong, the sensitivity is high, a result is quickly obtained, pollution is not caused and a product can be detected in real time; the avian leukemia virus can be detected out in real time by sampling according to the established system, and the detected result can be quickly and accurately obtained, so that convenience is brought for simply and quickly detecting the avian leukemia virus.

Description

technical field [0001] The invention belongs to the technical field of avian leukemia virus detection, in particular to a LAMP kit for detecting main subtypes of avian leukemia virus. Background technique [0002] Avian leukosis virus (ALV) can be divided into 10 subtypes from A to J according to its host range, interference of different subtypes and its envelope neutralizing antigen characteristics, and A, B, J and E are common in chicken flocks Subtype. Since the emergence and prevalence of avian leukosis in China, it has been highly concerned by clinical veterinarians, breeders and scientific researchers. In actual production, there is an urgent need for technical means for the general survey and purification of the disease. Although there are many reports on the detection of ALV, such as enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, etc., quantitative competitive PCR, in situ PCR, RT-PCR, etc., are used to detect nucleic acid. —Annealing—extension, p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/6844C12Q1/70C12Q2531/119
Inventor 韦平彭昊韦天超磨美兰吴元俊秦丽莉石梦霞毕玉彧宋丽丽王培坤
Owner GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap