Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from prokaryotic system

A HIV-1, separation and purification technology, applied in biochemical equipment and methods, enzymes, hydrolases, etc., can solve the problems of low yield, complex purification process, etc., achieve small volume, high protease activity and purity, and dialysis process. mild effect

Inactive Publication Date: 2014-01-22
TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In the present invention, we use the method of genetic engineering to express HIV-1 protease in a large amount in Escherichia coli. HIV-1 protease is highly hydrophobic and mainly exists in the form of inclusion bodies, which needs to undergo protein denaturation process. The purification process of HIV-1 protease is relatively complicated and the yield is low. After technical improvement, we optimized the separation and purification method of HIV-1 protease prokaryotic system and applied it to the research of crystallography and enzymology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from prokaryotic system
  • Method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from prokaryotic system
  • Method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from prokaryotic system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Expression of HIV-1 protease

[0050] Design primers for PCR ( image 3 ) amplifying the HIV-1 protease coding fragment, recovering the PCR product and the pET-11a vector, digesting with Nde I and BamH I, recovering the target fragment, connecting the digested fragment with the linearized vector and transforming E. coli.DH5α competent cells. The transformed clones were picked for double-enzyme digestion identification, and the positive clones were subjected to DNA sequencing.

[0051] Table 1: PCR process

[0052] process temperature time pre-denatured 95℃ 10min transsexual 95℃ 30s annealing 55℃ 30s extend 72℃ 30s

[0053] PCR upstream and downstream primers are: no specific sequence listed,

[0054] 5'protease-11a-s ATCATATGGCCGATAGACAAGGAAC

[0055] 5'protease-11a-as GCGGATCCCTAAAAATTTAAAGTGC

[0056] Gene sequence of HIV-1protease:

[0057] GCCGATAGACAAGGAACTGTATCCTTTAGCTTCCCTCAGATCACTCTTT...

Embodiment 2

[0061] Example 2: Purification of HIV-1 Protease Inclusion Body

[0062] Suspend the expression bacteria collected by centrifugation in solution A (20mM Tris-HCl, pH8.0, 500mM NaCl, 2mM EDTA), add nuclease DNase I, and use a low-temperature ultra-high pressure cell disruptor (Guangzhou Juneng Biotechnology Co., Ltd.) Lyse the cells, adjust the high-pressure bacteriostasis instrument to 1200bar, repeatedly pressurize the bacterial solution 3 times, then add 2% TritonX-100 and 2% Tween20 to the bacterial solution, stir evenly, and use ultrasonic (Scientz-IID ultrasonic cell disruptor) ) treatment, ultrasonic power 300W, on for 4s, off for 6s, ultrasonic for 20min, then centrifuged at 15000rpm / min for 30min to collect the precipitate, HIV-1 protease exists in the precipitate in the form of inclusion body. Wash the precipitate with 50ml solution B (20mM Tris-HCl, pH8.0, 500mM NaCl, 2mM EDTA, 2% TritonX-100, 2% Tween20), method: resuspend the precipitate evenly with solution B unti...

Embodiment 3

[0064] Example 3: Refolding of inclusion body protein by dialysis

[0065] Test material: dialysis bag, purchased from Beijing Baierdi Biotechnology Co., Ltd., dialysis bag D21mm (dialysis molecular weight 3500).

[0066] Treatment before use:

[0067] 1. Cut the dialysis bag into small pieces of 10-20cm.

[0068] 2. Boil the dialysis bag in 2% (W / V) sodium bicarbonate, 1 mmol / L EDTA (pH 8.0) for 10 minutes.

[0069] 3. Rinse the dialysis bag thoroughly with double distilled water.

[0070] 4. Boil the dialysis bag in 1 mmol / L EDTA (pH 8.0) for 10 minutes.

[0071] 5. Thoroughly wash the dialysis bag with double distilled water and store at 4°C. Make sure that the dialysis bag is always submerged in the solution. Gloves must be worn when handling the dialysis bag after handling.

[0072] 6. The dialysis bag can be stored in 20% ethanol at 4°C for a long time. Before use, fill the dialysis bag with water and drain it to clean it.

[0073] Dilute the protein solution with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from a prokaryotic system. In the method, a low-concentration detergent and ultrasonic disruption are combined to separate impurity protein from target protein, and an Amicon stirring type ultrafiltration device is used in an operation process, so that the purifying time of the inclusion body protein is effectively shortened. Moreover, the protein renaturation in the method is implemented by dialysis renaturation, the dialysis process is mild, and the activity and purity of the renatured protease are relatively high. The protein crystallization growth and enzyme kinetics measurement can be performed through simple ultrafiltration concentration, and the method is applied to the study of crystallography and enzymology.

Description

technical field [0001] This application relates to the prokaryotic expression and purification method of type 1 HIV protease and the application of the obtained type 1 HIV protease in crystallographic and enzymatic research. Background technique [0002] AIDS, Acquired Immune Deficiency Syndrome (AIDS), is a disease that spreads around the world and seriously threatens human health. AIDS is an infectious disease caused by human immunodeficiency virus (HIV) infection. HIV attacks the most important CD4 lymphocytes in the human immune system, destroys the human immune system and causes the body's resistance to decline severely, thereby infecting other diseases and leading to various co-infections and death. [0003] In virus taxonomy, HIV belongs to the genus lentivirus of the family Retroviridae. Currently, two types of HIV have been found, namely HIV-1 and HIV-2, both of which have similar virus structures and transmission routes. HIV-2 is mainly distributed in West Africa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/50C12Q1/37G01N21/64
CPCC12N9/506C12Q1/37
Inventor 饶子和杨诚郭宇周红刚唐延婷丁宏兰王文明张坛杰陈卫强刘慧娟李爽
Owner TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com