Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cimicifuga triterpenoid compound and application thereof

A technology for Cimicifuga triterpenoids and compounds, which is applied to Cimicifuga triterpenoids, the preparation of antitumor drugs or the application field of tumor personalized targeted medical technology, can solve the problems of few reports on plant compound screening and the like

Inactive Publication Date: 2013-06-12
KUNMING UNIV OF SCI & TECH +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, there are few reports on the application of this system to the screening of plant compounds.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cimicifuga triterpenoid compound and application thereof
  • Cimicifuga triterpenoid compound and application thereof
  • Cimicifuga triterpenoid compound and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Compound KY40 separation and extraction of

[0023] In September 2008, Yunnan cohosh was collected from Yangla Township, Daocheng County, Sichuan Province ( Cimicifuga yunnanensis 1.5Kg of the above-ground part sample, the plant species name was identified by researcher Qiu Minghua of Kunming Institute of Botany, and the crude drug specimens are deposited in the State Key Laboratory of Phytochemistry and Western Plant Resources Sustainable Utilization of Kunming Institute of Botany, Chinese Academy of Sciences (KUN No. 200809007).

[0024]Crush 1.5Kg of the aerial part of Cimicifuga yunnanensis, soak and extract with 95% methanol (5L) at room temperature for 3 times, each time for 1 day; combine the extracts, concentrate under reduced pressure at 50°C until no methanol is evaporated, and obtain 137.8g of extract ; The extract (137.8g) was mixed with 250g of silica gel, normal pressure forward silica gel (2000g) column chromatography, chloroform-methanol ...

Embodiment 2

[0034] Example 2: Antitumor Activity of Cimicifuga Triterpenoid KY40

[0035] 1. Construction of screening cells: wild-type mice were used as carriers, and p53 gene-deleted mouse embryonic fibroblasts (p53 - / - cells) to construct mouse tumor cells (p53 - / - +S+Ras, p53 - / - +V+Ras), the specific steps are as follows:

[0036] (1) Construction of vectors for Ras mutant genes and vectors expressing p53S mutant genes

[0037] For the construction method of the vector, see the method in patent ZL200910095184.3, that is, the p53S or Ras mutant gene cDNA is connected into the PQCXIP (purchased from Invitrogen) vector by conventional genetic engineering methods, and the p53S or Ras sequence constructed in the vector is sequenced For verification, the constructed vector is used in p53 - / - The p53S or Ras mutant gene is introduced into the cells.

[0038] (2) Transfection of p53S or Ras mutant gene vector

[0039] (a) Preparation of phoenix cells

[0040] The day before transf...

Embodiment 3

[0053] Embodiment 3: The experiment that compound activates tumor suppressor gene p16 activity

[0054] 1. The construction of p16-GFP-reporting vector, the specific method is as follows:

[0055] (1) The green fluorescent protein GFP reporter gene was excised from the pAcGFP1-N1 plasmid (purchased from Clontech) using BgLII and NotI double enzyme digestion, and the Luciferase reporter gene in pGL4.82 (purchased from Promega) was replaced to produce pGL4- GFP vector;

[0056] (2) Design primers for the promoter region of the p16 gene (5'GCTCGAGGATGAAAATTACCCTCC3', 5'GGATCTCTTTTCCTCGCGGAGAT3') to amplify the promoter sequence and connect it into the pGL4-GFP vector, thus obtaining a reporter vector fused with the p16 gene promoter and GFP -- ---p16-GFP-reporter vector.

[0057] 2. The reporter vector fused with the p16 gene promoter and GFP is transferred into mouse fibroblasts (MEF), the specific method is as follows:

[0058] (1) Extract the plasmid with the TIANGEN BIOT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cimicifuga triterpenoid compound and application thereof in preparation of anti-tumor drugs. Shown by targeted screening results directed at tumor-specific mutation gene products, at the concentration of being non-toxic to wild-type normal mouse embryonic fibroblast, a compound KY40 can selectively kill tumor cells with tumor-specific mutation genes; and shown by a GFP (Green Fluorescent Protein) reporting vector screening system of a gene p16 promoter, the compound KY40 can act on the p16 promoter, and shown by the characteristics, the novel cimicifuga triterpenoid compound and pharmaceutical compositions taking the cimicifuga triterpenoid compound as an effective treatment amount have application potential in the preparation of individualized treatment drugs directed at tumor-specific mutation genes p53 and tumor suppressor genes p16.

Description

technical field [0001] The invention belongs to the field of medicine, and in particular relates to a comichate triterpenoid compound and its application in the preparation of antitumor drugs or in personalized tumor targeting medical technology. Background technique [0002] Tumor is a kind of fatal disease that seriously threatens human health. Its pathogenesis has not been fully elucidated, and the treatment effect is not satisfactory. Most of the drugs currently routinely used in tumor therapy are designed for the regulation of DNA replication or cytoskeleton in the process of cell proliferation. While these drugs kill rapidly proliferating tumor cells, they are also highly toxic to normal proliferating cells (such as bone marrow stem cells, etc.) On the contrary, the resistance of the tumor decreases, and it is difficult to obtain a good therapeutic effect. Therefore, using molecular targeted screening technology, targeting tumor cell-specific gene mutation products, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07J71/00A61K31/58A61P35/00
Inventor 贾舒婷邱明华唐文如年寅罗瑛王海燕张继虹朱晖陆思千吴晓明
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com