Colloidal gold strip for TGEV antibody and PEDV antibody
A colloidal gold and antibody technology, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of low specificity and low sensitivity, and achieve the effect of strong specificity, ensuring specificity and sensitivity, and avoiding virus operations.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 PEDV S 1 Expression and purification of protein and preparation of monoclonal antibody
[0031] 1. PEDV S 1 Protein expression and purification
[0032] ① Extraction and amplification of the target gene
[0033] The gold standard protein selected by this colloidal gold test strip is the fragment S with better reactogenicity in the PEDV S protein. 1 Protein, for domestic popular strains, according to its corresponding S 1 The following primers were designed for the protein gene
[0034] Upstream primer: 5'-ACGGATCCGATGGCACCAGGTGATC-3'
[0035] Downstream primer: 5'-CTGAATTCATGACTGTCCATGACTC-3'
[0036] The RNA of porcine epidemic diarrhea virus was extracted using a kit (ROCHE kit). Specific operation steps: Add 200 μL of virus liquid and 400 μL of Binding Buffer containing Poly A to a 1.5 mL EP tube, mix well and let stand for 1 min, then transfer to a high-efficiency filter tube, centrifuge at 8000×g for 15 s to discard the liquid; add to the filter tu...
Embodiment 2T
[0067] Example 2 Expression and purification of TGEV S recombinant protein fragment and preparation of its monoclonal antibody
[0068] 1. Expression and purification of recombinant expressed protein at AD site of S protein
[0069] ① Extraction and amplification of the target gene
[0070] The A and D sites with better reactogenicity in the TGEV S protein were selected for expression, and the following primers were designed for the recombinant expression protein gene of the AD site of the S protein according to GenBank comparison:
[0071] Recombinant expression protein of TGEV S protein AD site:
[0072] Upstream primer: ACGTCGACTGCTACGATGATTTCA
[0073] Downstream primer: GTAAGCTTATAGCCCCAACTATGG
[0074] Extraction of RNA is a routine operation of ROCHE kits. Use the kit (ROCHE kit) to extract the RNA of porcine transmissible gastroenteritis virus: add 200 μL of virus liquid and 400 μL of Binding Buffer containing Poly A to a 1.5mL EP tube, mix well and let stand for 1...
Embodiment 3
[0106] The assembly of embodiment 3 colloidal gold test strips
[0107] 1. Colloidal gold labeled antigen protein
[0108] Prepare gold solution by sodium citrate reduction method: add 4ml of 1.2% trisodium citrate solution to 50ml of boiling 0.02% aqueous auric acid chloride solution, continue stirring and heating until the solution is stable and bright red. Observing the colloidal gold solution under a transmission electron microscope, it is found that the colloidal gold particles are uniform in size, without oval or other irregular shapes, indicating that stable colloidal gold has been obtained.
[0109] With 0.1mol / L K 2 CO 3 Adjust the pH value of the colloidal gold to 7.5, and the protein to be labeled (S 1 or S T ) into the colloidal gold solution with adjusted pH value, and after standing for 10 minutes, add 20% polyethylene glycol (PEG) 10000 to a final concentration of 0.05%, and centrifuge at 2000r / min for 20 minutes at 4°C to remove unbound colloids Gold parti...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Dilution degree | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap