Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof

A protein kinase gene and expression vector technology, applied in the field of genetic engineering, can solve the problems of losing resistance to powdery mildew and rapid change of pathogenic bacteria races, etc.

Active Publication Date: 2015-06-03
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most economical and effective way to control powdery mildew is to use disease-resistant varieties. However, due to the rapid change of pathogenic species, most of the existing varieties in my country have gradually lost their resistance to powdery mildew.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof
  • Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof
  • Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Cloning of Calmodulin-like Interacting Protein Kinase Gene HvCIPK1

[0028] In the early stage, our laboratory used the cDNA samples induced by powdery mildew to hybridize with Barley 1GeneChip (http: / / www.affymetrix.com / products / arrays / specific / barley.affx) to screen and clone A serine / threonine kinase gene (Hv-S / TPK) induced by white flour in O. pilosa, physically located in the region of Pm21, was overexpressed in the susceptible wheat Yangmai 158 and showed high resistance to white powder Serine / threonine kinase gene Stpk-V, a key member of powdery mildew resistance gene Pm21, confers powdery mildew resistance in wheat, PNAS, 2011, 108 (19): 7727–7732). In order to further clone the powdery mildew resistance-related gene located in the segment of Pm21 of T. villosa, the present invention takes Hv-S / TPK as a starting point to screen the disease-resistant gene analogues around it.

[0029] A large number of studies have shown that there is a certain degree ...

Embodiment 2

[0033] Example 2 Analysis of the expression characteristics of HvCIPK1 after induction by powdery mildew

[0034] Real-time fluorescence quantitative qPCR analysis was performed using the cDNA of the non-induced and induced samples of T. villosa at different times as a template, and the primer pair P3 (TTCGAGGATTGGCCTAATTG (SEQ ID NO.5)) and P4 (GCACTGATGAGCTGATGGAA (SEQ ID NO.6)) , using the housekeeping gene Tubulin as an internal reference. The PCR reaction was amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad, USA) and fluorescence was detected. The 20 μl PCR reaction system contained 10 μl of 2×SYBR Green PCR MasterMix, 0.4 nmol / μl primers P3 and P4, and 2 μl of reverse transcription product. The amplification parameters were: 95°C for 10 min, then 95°C for 15 s, 58°C for 30 s, and 72°C for 1 min, a total of 40 cycles. After the reaction, the measurement of the melting curve was carried out. Quantitative detection of gene expression levels...

Embodiment 3

[0035] Example 3 Construction of expression vector of HvCIPK1 gene and its transformation Common wheat Yangmai 158

[0036] Using P5 (TCCCCCGGGATGGAGGAAAGGAGGACA (SEQ ID NO.7)) and P6 (ACGCGAGCTCTTACTCCTGTGGCTGCTGT (SEQ ID NO.8)) to construct the HvCIPK1 gene fragment amplified from the cDNA of T. villosa into the transformation vector pAHC-25 (publicly known, refer to Literature: Christensen A H, Quail P H, Ubiquitin promoter-based vectors for high-level expression of selectable and / orscreenable marker genes in monocotyledonous plants. Transgenic Research, 1996, 5:213-218.), double enzyme digestion with SmaI and SacI respectively Carrier pAHC-25 and the target fragment HvCIPK1 gene, replace the GUS gene coding sequence on the pAHC25 vector with HvCIPK1, connect and transform Escherichia coli to obtain a recombinant, and clone the target gene to the downstream of the strong promoter Ubi to obtain the expression vector pAHC-HvCIPK1 . Herbicide resistance gene (Bar gene) as a s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof, belonging to the field of gene engineering. The cDNA sequence of HvCIPK1 is SEQ ID NO.1, and the encoded amino acid sequence thereof is SEQ ID No.2. The gene is reported in the haynaldia villosa for the first time, expression is up-regulated due to the induction of powdery mildew germ, and overexpression of the gene in winnow wheat 158 of wheat variety resisting powdery mildew can improve the resistance of the winnow wheat 158 to powdery mildew germ. HvCIPK1 is an important element in disease resistant signal transduction pathway of haynaldia villosa and can be guided into wheat variety resisting powdery mildew, so that the resistance to powdery mildew is improved; the molecular mechanism exploring the action thereof can help to understand the broad-spectrum resistance mechanism of the powdery mildew.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a calmodulin-like interaction protein kinase gene HvCIPK1, an expression carrier and application thereof. Background technique [0002] Wheat is the food crop with the widest distribution and the largest planting area in the world, and it plays a decisive role in human food security. In the process of wheat production, it is threatened by many adversities (such as pests, drought, salinity, etc.), which restrict the improvement of its yield and quality. Wheat powdery mildew caused by the obligate parasitic fungus Blumeria graminis f.sp.tritici is the second largest disease of wheat in my country. hazards. The most economical and effective way to control powdery mildew is to use disease-resistant varieties. However, due to the rapid change of pathogenic species, most of the existing varieties in my country have gradually lost their resistance to powdery mildew. The isolation and i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/63C12N15/82A01H5/00
Inventor 邢莉萍曹爱忠胡佳梦钱晨李颖波王秀娥陈佩度
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com